Description :
From Genome Similarity Track
Location :
contig_40:167914- 169149
Transcript NameFunction/comments
g7347.t1succinyl-CoA ligase subunit alpha, mitochondrial precursor
g7348.t1hypothetical protein
g7349.t1hypothetical protein PHYSODRAFT_491233

Sequence
1235 bases(100 bases per row)
CGATTCACCAACGACCCCGAGACCGAGGGCATCATCATGGTGGGCGAGATTGGTGGATCTGCCGAGGAGGAGGCCGCCGAGTGGCTCATGGCCCACGGCG
ACCCCAACAAGCCCGTGGTGAGCTTCATTGCCGGCACGACGGCTCCCCCCGGACGTCGTATGGGCCACGCTGGCGCCATTGTGTCGGGCGGCAAGGGCAC
GGCGGCTGGCAAGTTCGCCGCGCTCGAGGCCGCTGGCGTCGCGGTTACGCGATCGCCTGCTCGTCTTGGTGTGACGCTGTTCGAGGAGATGAAGAAGCGC
GCATAAACTACCAGCCCATGTGCATTAACAGAAGGAGGCAGCGAGCTCGATCTGCAGCGGCGAAGGAGCTGAGACGAAGACGAACACGCCAGTCACTGGG
TAGCTGGGTCCGACGTTTGCTAGAGGCGAGGCCCGTTCCTCTCCTGATTTAGTCACGTTAAACTACAAACAAAAGAGCATGAAAAACTCAATGGCAACTT
CAGTGTACTCAGCGTTATCGCTCGGTTAACAGTTTACAGCTGGGCGTCCTGGTACATCCACTTGTCGTTCTGGAGCTGCTGCGCCTTGCCGCGCAGACTC
GTGAGCGTATCCTCCAGCAGCGCTGCCAGCATGAGCACCACAAACGTCTCACCCATCAGCACTCGACTATAGATATTGTACCTCCATTGCGTCTGAGCTG
ATGATGTCGCACCATTGCTCAGGTCCCTGGCCGCCTCCTCCTTGGCTTTGCGCTTTTTCTCCAGCAGCAACAGATCCTGCGAGACTGCAGGCAGCATCGT
CAGATCAATACACAGTACTAGAGAATCACTCCACTGCAATAGCCTACTGCTGTCGCTCGCAGGCAGCGCGGACGCACTCGCCGACGCCGTGCTCCACCTA
GAATTCATCGCGACGTGGAACTTCACATAACATTTACACAAATATGTACACCAATCTCACATCAATCATACACAAGTCTCACTTGACGATTGTCCGGATA
AACGATGAGCGACGCCGAGGTTACCACGCCGCATCCGGAGCAGGACGCGCTCACTGTCGGCGATGAAGCGGCCGCCGGCTTGAAGCGCAAGCGCGTGGTG
CTGTCGATCCACGACAAGCAGCAGGTTCTGCTGCGCCTGCAGGGCGGCGAGCAGCCCATCGCCATCGCGCGCGAGTTCGGCATCAGCCGCCAGCAGGTCT
CGGATATCAAGAAGAACCGGGAGCGCATCGTGGCC