Description :
From Genome Similarity Track
Location :
Scaffold_72:16790- 18002
Sequence
1212 bases(100 bases per row)
CGTGCAAGGCTACATCGATGTTATATCGACAACGGATTGTTGTGCTATCGCACGGATATCTCGGATACACCGCGTATCATTGTTCCACATGATGAAGAAC
TGAAGTATCGCATCCTCTATGAGGTGCACGACACCGCTATTAGCGGTCATCTCTGTAGTGAGAAGACCTACGGCTTAGTAAGCCAGAGGTTCTGGTGGAT
CAAACTCTATAAATGGTTAAGCACTTACGTGCGCACATGTGAGCCGTGCCAACGGGTCAAACTCTCGGTACATATGACTTCGCTACTGGATACTTTGCCT
GTACCCTCTTGGTGTTGGGAGTCCATCAGCGTGGACTTTGTGTTTGGTCTACCGGAGGATTCGGAGTGCAACACATGTATTGTGGTCTTAGTCGACCGTT
TGAGAAAAATGGCTCATTAGCGGCTGTCCCTGATTTGATTGATGGTGAAGGTACAGCTTTGATGTTTATTGATCGCATGTTTCGACAACACGGCCTGCCA
CTGGCAATTGTCTCTGACCGCGATCCTCGTTGTCCGGGAAAGTTTTGGAAGGCCATATTTAAGGTGCTCGGCACCGGATTAGACATGCCTACAGCGGATC
ATCCGTAGAACGATGGTCATACTGAGCGTGTTAATTGCGTACTCTGTGAAGTCTTACGCAGAGTGTGCGCTGAGACGCCTCGGCGTTGGATCTCAATGCT
CCCCATTGTTGAGTTCGCCATGAACGATGCCGTCCATGCCTCGACCGGCTCTACTCCGTTCTATGTGAATGGCCTTATCCACCCTCCGTGTTCCATTGAC
GCTACCACTACGTCGTTCAGGGCTTAGGGGAAGAGTTGTCTGGTCGGCTTGCTGATGTCAGCTCTTCTACTGTTCAAAACCAGGTGATTGCGTTCCTCAC
AACGCGATTGAATGTCTTGAGACATGTGCGTGACGCAATGGCTGATAGCCAATACAAACAGAAGGAACAAGAGGATGCTAAAGACAGGAGCTGTATCGAA
AGTTATGAGGTCGGTGACCAAGTCTTACTGAACGCTAAGAGCCTACCTACAAAGGTAGGGTCTGTTGTGTTTAAGACTAAACTGCGTCCTCGCTTCATTG
GACAATTTACGATCGTGTCCACGAAGGTTCTTGCGTATACGCTCAACTTACCGCGCAAACTGCGTACAGAACACGTGTTTTACGTTGGCCTCCATAAGCC
GTATCGGGATCC