Description :
From Genome Similarity Track
Location :
Scaffold_2295:1679- 3529
Transcript NameFunction/comments
Phyag_g12310hypothetical protein PHYSODRAFT_344705

Sequence
1850 bases(100 bases per row)
CCTCGGCGCCAGGAGCACCGCCAGCCGCAGCGTACATCTTCTGCAGGATGGGGTTAGCAACGCCCTcaagctccttctgcttgccCTCGTactcctcctt
ctcggccGACTGGTTGGCGTCCAGCCAGTTGATGGTCTCCGTGACcttgtcgtcgatggccttcttgTCATCCTCCGAGATCtggtccttgagcttctcg
tcgttcAGCGTGTTGCGCAGGTTGTAAGCGTAGTTCTCCAGGGCGTTCTTGGCCTCAATGCGGACCttgttggcctcgtcctccgacTTGTACTTCTCGG
CCTCCGCCACCATGCGGTCGATGTCGGCCTGAGACAGACGGCCCTTGTCGTTCGTGATCGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCCACGGCCGA
CACGTTCAGGATACCGTTCGCGTCGATGTCGAACGTCACGTCGATCTGAGGCACGCCACGAGGCATGGGCGGAATGCCGTCCAGGTTGAACTTGCCCAGC
AGGTTGTTGTCGCGCGTCATCGAACGCTCGCCCTCGAACACCTGGATCAGCACGCCGGGCTGGTTGTCCGCGTACGTCGAGAACGTCTGCGACTTCTTGG
TCGGCACCGTCGTGTTACGAGCGATCAGCGTTGTCATCACACCGCCGGCCGTCTCCAGACCCAGCGACAGAGGCGTcacatccagcagaagcaggtcctg
cagcttctccgacGAGTCGTTGCCGCTCAGGATGGCGGCTTGCACCGTAGCGCCGTACGCAACAGCCTCGTCCGGGTTGATCGACTTGTTGGGCTCCTTG
CCGTTGAAGAAGTCcgacagcagctgctgcaccttggGGATACGCGTCGAGCcgcccaccagcaccacctcgtgCACCTGGctcttcgacagcttggcgt
cgcgcagcaccttctccacgggctccatcgtcttgcgGAAGTAGTCGCCGCACATGTCCTCGAAGCGGGCACGCGTGATGGTCGAGTTGAAGTCAATGCC
GTCGAACAGAGAGTCGATCTCGATGTACGCCTGggccgacgacgacagcgtgcGCTTGGCGCGCTCGCAGGCAGTCCgcagacgacgcagagcacgCTGG
TTCTCCGTGATGTCCTTGCGGTGCTTGCGCTTGAACTCCTGCGTGAAGTGGTCCACGAGGCGGTTGTCGAAGTCCTCACCGCCCAGGTGCGTGTCACCGG
CAGTGGCCTTCACCTCGAAGATTCCCTCCTCgatggacagcagcgacacatCGAAGGTGCCGCCGCCCAGGTCGAAGATGAGCACGTTGCGCTCGCCGCC
CTTCTTGTCGAGGCCGTACGCGATAGCAGCGGCCGTCGGCTCGTTGATGATACGCAGCACGTTGAGGCCGGCGATGGCGCCGGCGTCCTTGGTGGCCTGA
CGCTGCGAGTCGTTGAAGTAGGCCGGTACGGTGATGACGGcgttcttcacctccttgCCGATAAAGGCCTCGGCCACCTCGCGCATCTTGATCAGCACca
tggacgagatctccTCGGGCTGGAACGTCTTCGACTCGCCCTTGAAGTTCACCGTGATCTGCGGCTTGTCGCCGGCGCCCGACGTCAGCTTGAACGGCCA
GTGCTTGATGTCAGCTTGCACCACCGGGTCTGAAAACTTGCGGCCGATCAGACGCTTGGCGTCGAACACTGTGTTGTGCGCGTTCATGGCCACCTGGTTC
TTGGCAGCGTCGCCAATGAGTCTTTCTGAGTCGGTGAAGGCCACGTACGACGGTGTAGTGCGGTTGCCTTGGTCGTTGGCGATGATCTCCACGCGGTCGT
TCTGCCACACGCCGACGCACGAGTAGGTCGTGCCGAGGTCGATGCCGACC