Description :
From Genome Similarity Track
Location :
Scaffold_389:16789- 19016
Transcript NameFunction/comments
Phyke_g9108DNA replication licensing factor MCM5

Sequence
2227 bases(100 bases per row)
CGACTACTTGACGCGGGACACGAACTTGTACTGGCTGAGCTGTCGGAGCGAGCCCTTCTGCACCATAGCTCGGATAGCTCGCTGAATGGCGTTCGGGTTG
TAGCCCTGAGCCTCAAGGCGGCTGTAGAGCGCGCTGGTTTCGACACGCGTGCCAATACGCAAGGTACGGTTGATGCTTTGCTCCACCTCCTGAGCCTTCT
CGTGGAAGCCGCCAAAGAGTCCTTGCGTGCCGCCGTCTTTAGCAGCGTTCATCGTACTCACACTAAAGAGACGAATAGCTTCCTGCACATGCTCACACGT
AGCCTCATTGAGTAGGTGCATCTTTGCCAATGACTCGGAAATCCGCACAAGAGCTTCAAGCTGTCGCACAGTGACGGGAATCGTGGTTTCGCCATCTTGA
GTGCGACGAACATCGTCGCGCACACCTACGTAAAAGTCCTGTAAAGCCTGTGCCGCCCCCACTGAAAGTCTCGGAGCGCACCGTGCACGACAGTACGTGA
TGAATTTTTTCAGTAGCCAGGGCTCAAATTCTCCGCCACTGGATGCATTTTCACCAGCTGAAGGTTTTCCAGCCGCTGACGCTAGTGCATTGGTGTGCAT
CCGCACAACATGGGCCGCCATTTGTCGGTCTCGTGCATCGTCTTGAATATCACGTACAATGAAAATCATGTCGAACCGACTCAGAATTGTGCTCATGAGG
TCGATATTCTCTGAAGCCGACCGCATATCATCGTAACGACCAAACACTGGATTGGCAGCGGCCAATACACTTGCACGGGAGTTGAGAATGGTCGTGATAC
CTGCTTTTGCAATGGAAATCGTTTGTTGTTCCATTGCTTCGTGAATAGCCACACGATCCGATTCACGCATTTTATCGAACTCGTCGATACAAACCACGCC
ACCGTCTGCCAGTACCATAGCGCCCCCTTCAAGGTAAAATTCGCCTTTAGCATCTCTAATCACAGACGCAGTGAGACCCGCAGCACTACTACCTTTACCG
GAAGTATACACCCCCACAGGTGCAATTTTCTCGGTAAATTTCAAAAACTGCGACTTGGCAGTACTGGGATCACCTAAAAGTAAGACATTAATGTCTCCAC
GAAGAATCATCCCATCCGGAAGACGTTTACGTGATCCACCAGCCAGTAAACAAGCAATTGCtttcttcatgttgacagTGTAGTCACCATAAATGGAGGG
GGCAATACTTGTGGCTAACTTGTCGTAAAGTTGCGGATCACGTGCCATTTCGTGGAACTTTTCCTCTTCGGCAGGTGAAAAAGTGGCTTTGGCACGCCCT
GCCCCTTCTTCGTCGATTTCGATGCCCACAACACGCAAGTAAAGCGTGCGGATGGCAACTGCGCCAACATTTTTACCTCCAGAGTTAACCACAGAGGTAA
TCCCCACAACGGAAACTCGTGTGCCAGGTGAAGCCCTATCCACCAATTGTCTATCCGCAATGAGTGACAAATTGCGGGGCATTTCTCCAGTCGGTACCAC
TTCCGGGTTCTCTTGTAACTTGAGTGTCTGCTGGTCCACGTAGTCGCCCTTATCGGGCAACACTATGTATGAGTCTCTAGGACACTGCTCTCCGGCTGTC
ACTgtatcttcatcctctttgTTCCGATCACAAATGCGAGGGATAGACACTCCCCCTAAACCGGAAACTGCTACTCGTTTTGTGTGTCCGCAGTTACGAC
AACGCAATGTTGCCGATACGCATTTTGTGCGCACTCGAGTTGCACTGATGATAATTCCTGGAACTTTAACTAGTCGGTTGATTTCTTGGGCGTGAACATG
GCGTAAAGCGACAGGGGCCTGGTCACTCGTCAGAATCGCTTGGATGTCAGGCAAATGTTTGACTCGGTCGGCTGCGTCTATTACCTCTCCCTCTTGCGCA
GAGGAAGCCAAGAGTTGCGCCAGCATTTCCTTGGCCGCATTTTCCAAAAGTGGCAATTGGTCCTTGGGGCTTTTAAGTAGCAAATCTTGCAATTCTTGGT
CGAAAGCTGCCAAATGTGACAAATTTACAGTCACAAACCAATGGTTACGCCGGGAGTTAGCCAGGAGCTGCTCTCGATAGTAGAAGAGGGGGCCGACACG
GAAACCGCGCAGAAAAGAGAGGAGACGGCGCTGGAGAGCAGCAGGACTCGCGGTTTGGCGGGCGTCGGATGCCTGGGCGCTCTCCATGCCCACGGCGGAC
ACGCGACCGGCATCCCAGTCCATCGTG