Description :
From Genome Similarity Track
Location :
Scaffold_97:16783- 25789
Transcript NameFunction/comments
Phyke_g4226hypothetical protein PHYSODRAFT_507752
Phyke_g4227protein kinase, putative
Phyke_g4228hypothetical protein

Sequence
9006 bases(100 bases per row)
GAATCTCGCGCTGTTTGCCGCGCTGCCCGTAatcgtggcgctgctggctTTCATCTGGATGCCCCCAGAGTCTCAGCCTGATGTTGACCACGTCTCGACT
GCTTCAAATGAGTCGCTAGTGAACAAATACGCGAGCCAATTGGGGCATATCGCCACGCACGCACTATTATCAACGGGAGAGAATTGTCGCGAGTTCCAGT
CCGCTTCAGAAGATTTAACGCACGTGGAACAAGTTCTGGGCCAACAGCAAACACTCCAAGCCCAAAGCCAAGTGTTTCTGATGCTGAATGGCAAAAACGA
GGGGCTCTACTTCCCCTGGACGGACACAGACACATGTCTGTTGGAGCTTGCAGAGacagcagctctgcaactTGGAGCAGAGGCTGATCTGGTAGTCAAC
GGTCTGAGATTATTCTCTACCGACGGATTGCCGATCCTCACAGCAGAGGAATTAAATGCGCAGCGTATTGCGCACGTGCTACTGCAGTCCCAGATCTGGG
TCTGGCCTGGCATCAAGGTGGGCTACGTCCGTGAGATCGAAGGCTGCACCGTCACAACGCAGTCTCTCCGTCCAAAGATTTTTACAGTCGAGGGATTCTT
CACACAGGAGGAAGCGGACGCTATTATCTCTCAAGGTATTAATCATCTCACGCGATCTCCTGTGGACAGCCCGGAAGCCGACGACGGGTATCATTCTGAT
CGCACGAGCTTCACAGCCTTCCTTAACGACAGCCACTTTACACGCGACTTCCGTGCGCGATCGTCGCGACTCGCTCGACTTCCGTCGCCAAGTTTTACCG
AACGGATGCAACTTGTTCGGTACGAAACAGGACAATTCTTTCGCAAGCACGAAGACTATTTTGACTCTAAAGAGTTTTTGCCGCACAAACAATTGGCTGA
AGTCGAGTTTGAGGTCTGGACTGAATGGGCATCGTCGGAAATCGACGAATTCCGCAGCCAACATGGTGACAGTGCTTTTCCAGATGAGTTCTTGCCTGGT
GGCGTTATGTTTCCAGATTCACAGAGCACGACGACATTTCACCACGCGCTATTGAAAAGTTTTATGGAGGACGCCAAAACCACTGACTTCTTCTTAGAGC
ATGCTGATGTCGAGTGGGGCGAGTGGATTGACGAGAATCTGGCTCTTGGAGCGTCTGACATTATTGGCTCACTGCTGGAAAGCAAAGGCTACATGATGCC
GTTCATCGTTAAGTCATGGGAAAAGCGAGTTGCAGTACCAGAACTTGTGTACAAGTTCCCGAAGCGCGAGGTTAGTGGTGTTTCGCATTACTTCCAATGG
ATACGCTGGGCAAAAGAGCGTGTACAGGAGTTAATTGACACTCAACCAGAGGCTGTCCCAAAGATCGTGATGCCCGAAGGAGCTGACTACCCGACCTTCT
ACGTGAGCTTTCAAAATCGTCTGGTTAGGTACATCATCGAAGACTACACTGAAGAGTTCCTAAGTGAAGAACTCGGTGCAGACTGGTATCACTGGCTGGt
tgaaaacaaaaacagcaacGATGTGTTGCTAGAAATACTGCCGGATTATCCGCAAGTGTTTGACTTCGCTCTGGAGGCGTGGACCAAGCGTGCTGGCGAG
TTGTTCGTGTACGAAAAACCAGAGTATCTACATCACTTTGAGCCGAATCGGTTCGCGACTTTGTTTCTATACCTGAACGACTGCCCCGAAGGTGGCGAGA
CGGTATTTCCATACTCGAAAGAGCGCTTGGTGACCGGTATTGAGCGGAGTGGCATGGCTGAGTGTTCTGAGGGGCTTGCAGTACCGCCCATAAAGCTCAC
GACGTCATTTTTCTATTCACAAACGCCGATGAACGACGTGGACCCGTCCAGTCTCCATGGTGGCTGTCCTCCTGCAAAAGGCATCAAATGTACGTAGTCG
CAGCTCGTTTCACTTGGCTTGATGTTCGTGTGATCGAATTAAACGCTTGTGTTTCATTTTTTCTAGACGGAGCCAACTCGTTCATGTGGAATActgatgc
tgatgaaggaTCCAATGCGTGGGGGCTGGGTGATGACGATAGAGAGGTAATTATTCACACGTGAAGGAAGCTATTGTTGTACGTGGTAGTGGCAGTGGTG
TGTTCATAGTACCAACCTTTGACACAATTCCTGACAGAGACTATAAAAAGCAATAATCACCACTATAATAAAGTTTAGGACGTAGGTTGGTCGTGCCTAA
TAATCATTAGAGCATCTAAAGCATGGGGCACACAGCGAGCGTTGATCGCCAGCGACGGGTTACGACAGGTACGCTCTATGGAGAACCTGCGGGtgcgact
gcagcacctcgTGGGAGCTACACGCCCGCACAACTTCAGGCTCTGTACCTGAGTCGAGGTCGTCCGGACATGGCGTTCATGTCAAACCAGAGTCAAGTGC
CAATTGAAGTTCCAGAGATGCAACAGACGTGCACAGTCAAGAACCACGTGAATCTCAAGAAGGCCAGTCTTAAGCTCCAGCAGTCGGCGTCTCAGTCAGA
GCAGTACGCTCTGTCCTTCCAATTTGACGCCACTAAGGCATGCAGGATCAAAGTCTACTTGGTGGCCAACGAGACAATGGACGCTGACACAGGCAGCTCC
AGTTTCACTCTTGCTCATCAAGACAAGATGCCAGTATTAGTGcaagagtttgctgctgggttGGGACAGAATTTCACTCTGACTGGAGAGGAGGACAAGG
AAGCTCCGaaagacgaggaagaccagcaaacacagcagcGGCCATTGCCACTTTTGGACCTTTCAGTTTATCAAGACGATGAATTGGTCTACAAAATCGG
CACAATGCAGTTTCCACTGATCGTTGTGCTGGAAGTCTCATCTGAAAGTACGGATTCACATTTCTACTTATGCTAAGACATTGTTCATCGTCACTGACGA
TTCTTGTTATATCCAGGGAAACATCCACAATCGCAATCGACGTTCTGCACACTTGTCAAGAAGGGCGACAATTGGGACATCAAGATGCTCAAGCAAAAAA
TTCTGGTACGATCGAAGTTTGAATTGGTGAacttgttgaagttgcaacTAATTGATGTTAACGTGGTTGCTTCCTAGGTGGATGGAATGACATATGAGCT
CCAGGAGATCTATGGCATCGATGGAtctgtggctgctgcacctAAAACTGGCGACCGCAATGTTGCAACTGGTGACAGCCAGGTTGACACGACTAAAGCT
GCCAAGGACGAGATTGACATACCTGAAGGTGCTGAGTGCATCATCTGCTTGTCTGAGCCGCGTAACACGACAATTTTGCCTTGCCGACACATGTGCCTCT
GCACTGAGTGTGCCGAGGCACTACGTAAGAGCTCCAGTACTTGCCCAATTTGCCGAACGCGTGTAGAAGCATTGCTACAAATCCGTGTCGAGGCAAAAGA
GACCGAGACCACAGAGGTGGAAGACGACTCCAAGTAGTAGATTGCAATCAGCAGCGAGGCCAGTGAATTATGAATACCATGCTCTCGTTGGCAAGGTGTC
GAGCGTATTGAAACTAATCTATGCAACCTATGTTCCCATGTGAGGACATCTTTCGCCAGTGGACATTTTCGACACCCTTTGTTATAAAGCAAATTGGATT
GTTATTGGTCCTCTCTTCCTATCTCGCCTTTGCCTTTTACGCTGTGCGAAGAGACCGTCAGAATGGAAGTTACCCTCGGCTCCCATCCTTTCCAGCTCTC
CACACACCGATCAGACTCTCTATCTTCGCAATCTCGTCGCCGCTACCGTCGCCGCCTATGCTGATTCCGCGCCTCGTTTTTCTTGTGCGTTTCCTGATTG
TTCTCTTGTACAAATACTGTTGACGTCGGCGGTGCGTGTTAAATGGTGAAAAAATTCGACACTGGGCGTTCAGTCTGCTTGTTCGCTAATTTTGCGCCTT
CATTGTCGATTAGTTACACCAAAACACATGCAGATAATACGTTACTGTCGCACCGCATCCACTCTGCTGCCCTGGCCTATGCTCGCACTCCACCGTAGAT
AAGATCAAACTGATGCCATGCTATTGAGGTCCCACGGACAGCTAGTTGTTCTTTCTCCACATCCCCTTCATCTATACAAATGACAACGAGCGTACATCAT
TAGTTCGAGCTCCCACAACCGTGAGTTTACTTACCTTGATCCCCACCTTTTTAGAGAAGTGAAGACTTACCAAGTTGGCGACCTGCCCTGGAGCGTCACG
GAGGCTTGATCCTGTCGACGGAGTCGAGCTGACATCACTCGTTGGACCATAGTAAGGGCTACCCTGGCCTTTGGCCGGATAGGCAGCACTCCCATTCTGA
AATCCACGCTGAGATTTCTGCGTGCCGGTCGCGTTCTCCTCCTGCCCTGCAGTCTTCAGGTCTCCAGACGACTGTGACTGGAAATCTGTTAGGGTCCGAC
CGCTCCGACCTGGAGGGCTTCCATTGTTCCCCCGCTTGGGGCTACCCGAACCATGGTTGTAGTTGTTGTCTGCACTGGAATTTGAGTCGTCCGAGGTAGT
GGGTGACGACACCTTGCCTGCATTGTACGACAACTTGCGGgtcatcatctccaccatctgctcgcgcttcttcaactCACTTTCCCGGCGCATATagtcc
acctccagctctaaaaaataaaataaaagtATGAGTCCACCATATTTACAATGACAAAATTTCCCTAAACTCTCACCTTTGAGTTTTTTCTCACGTGCCA
TCAACGCGGCCTCCTGACGTCTCAGGTCTTCTTCAatgcccagcagctccttcatcttctggtTGTACGACGTCTGCAGGTTCTGATCTCCTCCCGCTGG
GGGCGGCTGGGAATTGTGCGCCGCTGCGTACGCACGTAatctctgctgcagctgcgggACCCGTTCCAAGTCCTCGATCCGCGGTCGTCGCGACCGTTGT
CTGTGCAGCATCCAACGGATGACCTGAAAAAGGCCCTCCGAGTACTGGGATGGGATCCTCGTGAATTTGCCAGCGTTAATTTTCTTGGCCAACGCCAATT
GGTTGGTGGCATCGAAAGGAGGTCCCAGAGTCGCCATCTCGTACAGCAGACAGCCAAGCGCCCAAATGTCCGACCGGTCGTCGTACGTCATCTCATTCAC
CATTTCTGGACTCATGTAGTAAGGAGTTCCCACATTGGTCTGTGCAAAGCGAGATTCACTGCTGAGCTCCTTGGCAAGGCCGAAATCTCCGAGTTTGGCA
TTATTCTGAAGGAATATCACAATAGAATGTTAGGAATTGTAGTAGAAATGGACAATAGAAATAGAAATTAATAGCACGAACGTTTGAGTCTAGGAAAATG
TTGCCAGGCTTGATGTCACGGTGCAAAATGGGCCGAATGGCGTTGCCTTCACGGTGGCGGTGACACTCTTTTAGGGCCAGAAAGATGTGCGTGAAAATAT
GCCAGATGAAACCCTCTTCGATGTAGGATCTGAGTTTAGAGAGGTTAGAACGCACCTAAAGGTCAGAcacttttcttcttcatgttaAAGTAAAAAATGT
TGCAAAACGTACCCTTCACGTTTCTTCCGTTTGATGAATTGCCCCAGATCTCCACCTTCGCAGTACTCCATAACGATGTAAATCTTGGTCGCCTGCTTGT
CAATGACGCGGTCCAGGTATCGCACAATGTGCGGGTGGCGAAGTTCACGCAAGATGTTCACCTAACAGAGCACCGCCATACACATATCAGCATGTTTGTC
CACGCTCCTTGTCGCTTTAGACATTTCACCCTACCTCGCTGACGATCAGTTGCTTTTCCTTTTCACTCATGGCGCCATAGTTCACTTCTTTCCACACGAG
CATCTGCGTAACAATTTCACCTGTCAGTTTTTCCCTTAACCGTGACTAAACGTCGCTCTGGTTCCTCACCTTGCGGTCGGTCTTACGCACGATCTGCGTA
ACGACGCCAAAGGAGCCTTTGCCGATGATCCGGACCTGCTCGTATGCGTCCATGGTGCCGAGATCTCCGTTCAAAAAACCTTGGCGTAAGGGACGGTCTG
TAGCTGTAGTGTGTGTAGCCTGTTAGcctgtagctgtagctgtgGTTTAAGTGTGTCTTCTCTTGGTCGAAACGTCGAAGAAGGGAAGAAAGGGGgaaag
aggacgaagagcaaATGCCAGTGTTTAGACACTCACTTAAACGAGATAGAGAACTTCTCTCGCTCTTCCTCTAACTGTTGTTCTTCGGTTGTGCTTATCG
CGACGCCAGCCTCCGACTGTCCGCTCGCTGTCCTGCTCTCCCCCCACACCAACTCTCCCCCTCCACAACTCCAGGGACCTACCCCCAGTGTTAAATGAAC
TACCTGGTAGCCTAAACAACATATTTTGCCCAAGAAAAAGGGGAGCGGATCGGGTTGGCCTTATTCAAGTCAAGTCAAAAAGGTGAGGAAAAATTCGCAG
TAACGCACACCTAATCCGTCGCCGTACACTTACACTTGGCATGGCGAGATTACAAGTCGTCAGCATTGCGAATCTTTCATTTTTTTAGGCACAACGTTGT
CTCCCCGAGAAATGGCTTAAACGAGTGAGCTTCGTTACCAACGATACGTTTGAGCGTGGTCAGAGCAGGCGCAAGGAAAAATCACATTTAGTTTGAGTAT
GTAACTGGTATTTTACAACCCCACACGTTGCACTCGCGACCGTACTGTACCGACGCTGTGACCATTATCTGACTTCTTTGGCTACTTGGTAGTCATGGAT
ACTCGGTATAGGCTGGCAAAGTACAAGGAGCCAGCCCAAGCAACTTTAGAGCTATCTATCGACTTGCTCAAGTAGGAGTGAGAAAACAAAATGTTGGACA
CGTCCTCTGGAATTGAGGATGACCACCAAGCAGATTGAAAGGCGAACTGATTGTATTTTATCGCATGCTGCTATCATATTAATCACTGAAAATTGCTCGA
TCGATCCAAAGAGAGTCGGATTATGATCTCGACCAATTGATTGAAGCTTTTCGTGGGCGTATTCAAATGGCTACATACAGTACAAGCCCGTAGATCGGTT
AGAGATCCACATTATTGCCCTAGGGTGTTTAGTGCTCGGAGGCTAGCAACGCCTCCGAGTCAAGGGCATCCTCGTCCATCATAAGTGACactcttctctt
cttgccATTCGTGCCGTTCAGGATCGATCCATTCTGGTAGTCCACGACGTTGAGGGCGATCCCCACGAGACTGCCCAGCACTCCAAACGACACGAAGAGC
AATTCCACTCCTGGAATGTATCGCTCGTCGTGGTTGAATTCTGTAGCCACGGCAAGTGGGAAGAGTGATAACCCGATGTTCTGACAAGATACGCACACAA
ACAAGATGTAaagtcagcagcaagtccacCTTGCAACAattcaacaacaaaatatTTACAAAGCTTTTGACACACCTGGATGGCAGTGATGGCGCCGTAA
GCAGTTCCGACGTGCTTTGCTTGGACCACGTCTGCAATATAGGTATTCAGTGCACCGAACCGTAAGAATATTAACTAAAAGTTTAGCCATCAAGAAACTT
ACATGGAACCGAAGGCCACAACGCCGCAGCAAACACACTGTAGGCCACACCTTGAAGCACCAGCGGAACATAAAGATTCACGACGGTCAATCCGAGCATG
ATATGCACCGCCGTTAGTGCGAGAGGAGCCACCAGCGCCAAAAGCGCTCGAAGACCGATACGGTCCACCACGAAACCGAGGAACGGGGAGATGACGGCAC
TGATAATGTACGGAATGGACATTGGGGTCGCCGCCTTCTGTGCCGCCTCCGTTTTCGTCGCACAATAAATTTTCGTGAGGGGTCCCAATTTCCAGGCGTC
ATCATCACAATTGATATTGCCTCCTTCAATCAAGGGAGGAGACGTCGAACAGTTCCATTGATCCAATGGCTCTTTGATGGTGCAATTAGCCGATAGTAAT
GGCAGTGGCCATCCATAGGGAGGAACACTAGGACATCCTGGTGCAATCTCCCGACAATCAATTTCGTAGATATACtttccttctccacatcTTTGACACA
AATTTGGAGGTTCCTTGAAAAAATCTCGTTCCATAAGGAGACTACTGGCCACATTGTTGAATGGAATGACACATCCATAAACTACCAGACAACTGAGTGC
CAATAGCCAAAACGCCGGCCGAAAATGCTTGATATCACTAAAGTGAATACtctcagcagccacacctGCCTCTTTGAGTTTTTCTTGAGCTTTCTTTTCA
GCGCGTTTGTCAATTGGAATCACCAATAAAACAGTGAACGTTGAGCCCAGGCACATGATAACACCCACCCAAAGTGCGGTTGACacacttgcagcttctg
cgaCAAGTGGACTGAGTTCGTTGTTGATGACACTTCCCAGTCGAGCCACACTGAGGTTGATCCCCAATGCAAGAGCAAGTTCACTGTTTTTAAACCAGGA
GGCAACTAGTGTCCCTTGTGCAACACCTAAACTTTCTCCACCGAAACCAAAGACAACTCGACCAAACTAGTTTAAGAAATGAAAAGGATAGGTTAGAACA
AACATCCCACCTAAACAAATCTTTGCAAACTCGTACTAAAACTCACCAGCATTAAATTGAAACTGGAGAGTGAGCAACCTGTTGCAAAGATCAACTGCCC
TGCAAGAATTGCCGTTGAAAAGGCGAACAACATGACACGTGCGCCAAAACGGTCCACCAGTACACCACCGAAAAATGGCAACAGGATGTTCGGGATCGAG
TACAGTGTATAGAGTAAATTCTAACAGCAAACAAAAGAAAAAGCGTAAGCAAATATTTAACTCCATCATCCACACAAAAGTGCAAATTGTCTTAAAGTAT
CTATCCGCACGGTTAAACACATCTAAAGAGAAGCCGGTTCAACTTACGAAAAGAAACTCGTAGCGGGCATTGGGGATGTTGCTAAAATGCTGTTGCAACT
GGCTCTTAAGTGCCGCAGGGTTGTCGAAGCAATAGTAGTTGCCGATCATCAGCAAACATGACAAGAAAAGCACTAGCCAGCGCACGCGTAgctcgctctt
ctccat