Description :
From Genome Similarity Track
Location :
Scaffold_75:167804- 169510
Transcript NameFunction/comments
g12316.t1XP_009535314.1 hypothetical protein PHYSODRAFT_525670 [Phytophthora sojae

Sequence
1706 bases(100 bases per row)
GGCTTGAAGGTGTCGCCGGGCCACGTCGCGAACTCGCTGGCCTGCAGCCACCAAGCCGGGTATCCGATCGAGGCCATCTGGTCGGGAGCTTCGCCCGTCG
TCTTGTAGCCGTCGCTGTACTTGGCCACCAACGTCCATGCGAGTTCCCACCACTGCGCCACGACCTGCTCCGCGAACTCGTTGCTCTGCGCTTGCAGGCG
GGTAACCAGCTCGGTGTCACTCACGCTACCAGAGTGACGCTTTTCGTGCGCCTCCTTCTCCATCTTGCGTCGTCGGGCAAAGGCCTCCTTCTGCAAACTG
TCGATCTTGCCTCGAATGTCGATGCTCATCGAGTTGTAGCGGAGCAGACTCCAGTTGTTCACGAAGTTGAAGGCCCACCAGGCAGACTGCGGGTTGAACT
TGCTTTGTTGGCCCAGCAAATACGACTTGGGCACATCGTGCTGCGCGCAGGAGAACGGAACGAAGACCGAGCCGTGCGGGGCATCCTGAGCATACCATGC
AACGCCACCAACAGCATCCGGCCCCTTGTTACTACGACTCTGCAGAACGAAGGCAAACAGCGTGCGGTACATCGAGATCGGTCGTTCCCAGCCGCCAATG
ACGCCACCGGGGCTACCCGACCATCGCACAGGGGCTCCGAAGGGGCCAGCAGCCAAGCCCTTGGTCATGTCGTAGCGCGTGTTTTCGTAGTGGTCGCGGA
GTAGATCCATGATCTGGAACATCTCCACATTGCGGTCGGGCTTCACGGAGAACGGGTAGGTGGCGTACTGCGAGAAGCTGCCGAGACGGGCATCGAGCTG
CAGCGACGGAGCCAGCACGTCGAAAACGCGCCACACGCGGCGTCCAGTGTAAAGCGGGCCGATGGCATCCTTGTCCGCAAAGCCGTAGGCGGCAGTGAAG
TCGAAGGGCTTGTCCCCCTTCGGGTCCCACCAGTTCATTTCTTCAGCAAGCGAGCGCACATTACTCGAGGCCATGAACCAGTCGGGCTGGCTCAGGTCGA
TTTCACGGATCGTGAAGCCGTTGGCAATCACCGTCACATGACCGTCAGGCACGCGCTGCGCTGCCCACACAGCTCCAGCTTCGTCCTTGCCGGTCATGAC
GTGGAAGACCCAGACCTCACCCAGCTTATCTCCAACGACAAGCGCTTCAGCCGAGTCGCCGAAGTCTGGTTTCGCCATATCTCCGCTGTCTTCGCTGTAG
AAGCCGTACTTCTCGGCCAGCGTCCCCATGGTGCCCACAGCGCAGCGCGCAGTCGCACAGCGTTCAAGTGCGATCTTGGTGAGCTCTGCGATGCCGAACA
TGTTCTTGCCTCCAGGCACATTCAGCGGCCACCCGGCGGTCTTGGCCCCGCATGTACTTTCGCCAATGCTGAGCTGCACCTCGTTCATCATGCCATAGTC
CTGGTCGAAGTACCCATACGTGTGCTCCACCTGCGGGACGTACCCAAGCGGCATCATGTACTCCTGCTCCACCTCTGCTAGTGGGTCGTGCACAGGCTGG
TAGTGGGGGCCACGGTCCGGCGCCACTACTCTCGGGTATCCGCCGTTGAAGTTGTAGACGGCACGCTTGCTGCCCGGCTCATGATCTTGCGCCGGAACGC
GAACAAGGCGCAGATCAGAGGCTGCATCACCGGCATCGTCCGTGTGCGCGATCAGCGTCGAGTTGTCTGCGCTTGCTCCTTGAGTCACAGCAATTGCTGT
GCAGGC