Description :
From Genome Similarity Track
Location :
Scaffold_489:16780- 22248
Transcript NameFunction/comments
Phyta_totarag8748hypothetical protein

Sequence
5468 bases(100 bases per row)
TGAGTTTGTTGTGAAGTACTGGTCCTCACGGTTgctactggagcagcttAGCTTTTGTCTCGCCAGGTTTTATGCCGCAGTGCTTTTATCCTGCAGGGTT
TTGCTAAACATGTTACAGTTGGAGGGCACAAAAGCTGGGAAAGGTGAGAGAAGAAATGAGGGAGGCAGAAACAGAAAACTCTACTACACAAAATACActc
ggcagcaacaagcagccTTCCTCACAGCCATCAAACCACCTTTGcattcgtcttcgtctgtaCTAGTTGAGTTACCAGCTCACGCTTAAACAGTCAAGTT
ACAAGTGGTTATGAGCCCAACATCACGTTGGTAACTCATCAGACATTCGAAAACCATGAGTACGAGTGCAGATCAAAAGAAAGAGACtaaggaagagaag
aaggttgcCTACCCTCCGTTTGATGGCCAAGACTTCGAGGTATGGTTTGAGCGGATGAAGTTAAAGCTGGAACGAAAGGACCTATGGAAGTACTGCGAGA
AGGAGGTTGATGAGCCAGAAGAGTCGAAGCAGGACGAGCATGCAACCTGGAAAAAGGAGACGGCACGAGCGAAGGAGCTGCTCTACGATGGAATGACGGA
TAAGATTATGAAGACAGTGAAGTTTGAGCCTTCTGCATTCCGTGTCGTGGAGAGATTGAAGCAGAGATTCGTCGGAAAGACGTATTTCAAGTATGCAGCA
GAGATGACTCAATTAAGACAGCTTCGGCTTCAGCAGAATGGAAAGGTGTCGGATCATTTGGGTGAAGTGCGTCGTTTAATGGATCGAATTGCTTTATTGG
GTAAACCATTGGATGAGTACGAGAAACCAGCGCTTCTGATCGGCACTCTTCCTGCCACTTATGACAATGCCGTGGAGACTTTTTGGCTAGTCACGTTCCC
CACGATGTCAATGACCCACCAAACGATGCGCAACTAGAACATGCTCTTGAAGTGGCGTTTGATCGGCGTCAAGGCCGAAAGCTGGATGGAAAAGCTGAAG
ATCAAGCGCTGCTTGGTGGTTCTGGTAGAGGTCGAGGCCGAGGACGTGGTCGTGGCCGCGGACGCGGCTCTGATGGTGGCCGTGGAGGTCAAggtggagg
tcgtggagaCAACCAAGGTGGACGTGGTCGAGGTGGACAAACGGGCAGCAGAGGAAAATGTTTTCACTGTGGAGAGCAGTCGCACCAAGTTCGAGACTGT
CCACACTTGGGTAAACACCCACCAAGTGATGCTCGAGGAACCGAGccacagcagaagcaagTAAAACTAGGAGGCAATTCGCAAGGGAAGAAAGCTGCAA
CCAAGAGTCATTACGCTGGTGATACTAGTGATGATGGGGCATATATGATTTCTACTCTTCTGGAGCAGCCTCCACATATTTTTAAGTTGGCACCCAAGCG
TTGGTATTTGGATTCTGGAGCGACAAACCACATCACTAACCAGAAAATTGATTTCATCTCATTTACACCGATGAGTGCATTGGTGCGAGTTGGTGGTAAG
AACTGGCTGAATGTGGCCGGGGTTGGCACGGTGAGGAAGGAAATTCAAACCACAAGTGGGCGACGTACGCTGCTACTGCATGGCGTGCGTTATGTACCAG
AACTCCAGTTCAGCTTGTTTCCGGTGCGTCGACAGACCGCACCAGCACTGTCTGCTGATGAAAGGTGAAAGTTCACtttgatgatgatgctgttgctgaa
gtgaAGTTCCACCGAGGAAGTGTGTATGCCCATATTGATGAAACCAACCTTTATTGTTTGGAGCTGGAAACTCCTGTGACTTCAGCCATGGTAGTTGCAA
CCACTGGAAATCAAAATGTGCAGCTATGGCATACAAGGCTGGGTCACCCAGGACGAAGCGTATTTAATGCGCTGTTCCGGTATGCAGAGTGGCCACTTAC
TGCAGTTGATTTGAGGGTTGATGAATCGTTTAGTTGCGAGTCATGCGTCAAAGGAAAGTTGACCAGAAAGAGTTTCCACTCGACTCAAAGTGTTGCGAGC
TAGTTGGAGAGCTCGCTCACTTGGATGTTTGGGGGCCATATTCGGTTGATTCGTATTCTGGAAAGCGTTacttcgtcatcttcgttgATGAAGCTAGTCG
ATTTTCAACACTCTTTCTGATGAAGAGATCTACGAAATATTTGATCTCTACTACGAACGTGTGAAGACACAACTACAAGTGcggatgaaggagctgcgtA
GTGATAATGCGCTCGAGCTGACATCGCTCGGACAGCGGTGCAAACAGAAATACGGGATGGAATGCTCGTTGAGTGTGAAGCATACTCCAGAACAAAATGA
AGTTGCAGAGCGGATGATTCGCACAATAACGGAGCGCATGCGATGCATGATCGTGCATTTCGGACTACCCAAGCAGTTGTgggcagaagctgctgtcact
gctgcgTACAGCGTGAATATAGTTCCGAACTTGAAGAGAGGAATGGAAGTGCCGTATTCAGTGTGGTATCGAGAGACACCTGAATACTCAAGACTTCGGA
CATTTGGCTGTGCAGTTCTAGCGTACGTTGACAAGGTTGATCGTAAGAAGATGGAGCCAAAAGCGAAGGAAGCAGTATTTGTCGGTTATTCTCGAGAGCA
AAGGGGCTATCGTCTGCTAGATAGCAAGACGAATAAGTCATTTTATAGCCATACAGCCATCGTCTACGAAGACAAGCCAGGGCGTATCCTGCTGGAGAAT
GAAGAAATAGCTGCATCAAAAGTTTCGACGTCTCAGTACTTGGACATTGATGCTGCTACCATGCAAAATATTCCGTCACTATTACGAGAAGCTCAGCAGG
ATGAGATAAGTGACCCGGAGCACAGAACCGGTGGGGCTGCGGAAGGTGACGTTCAAAATACAGAGGCAGTTAAGCAGCGAAGTCAACAACGCCGAAAACG
TGAAGCTGACTTCGAGAGTGCAAGAATCCCACATAAAAGAGTGCGGATCACTGAACCAGCAAGTAGCCCACGCACTGAAGCACCAGTAAATGAGTCGAAG
GTGCCCCGTAAGAGAGCGAAGCAAACAATACTTTCCAGAAGGAAGGTGAAACGCAGAGGGCGGTGTATGACCTTGGCTGCAGAGTCTGAAAATGAGGGCA
GTGGGCGGTGTGTGACACCGACTGCAGAGCAAGATGAGAAAGCCACTGAGCCACTGCGGACTTCAACTCAGGAACCTGGTGAGATGACGACCACCAGACC
TGTGGAGCCTGAAGTTGATggcgactcggacgaggagcgcTTAGCAGCCTCCGGACAGCAAGAttcgtcgtgcagcaagGCTCCGAAGACCGGGTGCAGG
GAGCATTATCCAGTGACGAGGAGTGGAAGAGTGTTAAAACCACCACGGTGGCTGGGAGATAGCATCCATCTTGCATACAGAGGCTCAATTGAAAAGAGTC
CAGTGGGTTCATTGAGTTGGAAGGGGGGCACGTGATGAGATGCAACTTGAAATTGCGAAGGAGAAAGCATCGGATTGGTGGCAGGATTATTGCAGCCTAT
CAACAAGTGTCCTCACTGAACCAAACACACTGGAGGAAGCGATGAGTAGTGAACACTCTAAGGAGTGGCGAGAAGCAACGAATGCCGAGTATAAGGTCTT
GATGAAATGGTACTTGGAAGCTGGTACCTCGCAGGAAGGGCATGAAGGTGCTACGTAATCGTTGGATTTTTCGCATCAAGTGTCTTGCAAGCGGGGAGAT
CGAAAGATTCAAGGTCATATTGGTTATTAAGGGCTTCATGCAGATCTACGGGATTGACTACTTGGAGGTGTACTCGCCCGTGGTTCGCTTGGAGACATTG
CGAGTGCTGCTGACACTCGCAGCCGTTTGGGACTATGAGGTGGACCAAATGGACGTGACTACTGCATTCTTGAACGGCAGCATTGATGTTGAGGTGTATA
TGGAGCAACCGGAGGGGTATGAGGAGGAATGAAATGAAGACTGAGTCTGTCTTGCTGAAAAGTCTTTATGGCTTGAAGCAAGCCCCCGGAGTGTGGTTCC
GTCTGCTAAAAGATTATCTGGCAAGCGAAGGATACACACTCCTGAACTGTGACGCATGTGTTGCAGTGAAAGTGATCGATGGGTGGCTTGTGTTTATCTC
CATCTACGTTGATGATTTGATTCTGTTCATGCCCAATAAGGtgatgatgaagcagatgaagcaaATGCTTCACAAGCGTTTTGTGACGAAGGACCTTGGA
GCAATTTATTACATTCTTGGTTGGGAAATTACGCGCAACAGACGTGACCGGACAATATTCATTAGCCAGCGCAATTATGCAGACAAAGTTTTGCGTCGTT
TTGGGATGGAAAATTGCAATGACTGTAAAGTGCTGAGCACTGCTGACTTGAAGCTATCGAAAGTAATGTGTCCGATCACGAGAGAGGAAAAGGAATTGAT
GGCCGGAAAACCCTATCGTTCAGTAATTGGGACTTATGTACTTGATGTTGGGCATACGCCTGATTTTGCTTACCTGGTTCGAGAGTGCAGCCAATTCCTT
GAGAACCCGGGCGTGCTGCACTGGCGCGCTGCAAAACATGGCCTGAGATATCTTAAAGAGACAATGGACTGGGGGTTACGGCTTGGAGGTGCGCCATGGA
GTGAGCAGCAATTAGATGACCATCTAAAAGCTTTTGCCGATACTGACTTTGCGAATAGAGTTGATGATCGAAGTCTATTGCTGGGTATCTGACCCAGTTA
TGTGGCAGCACCATTTCATGGTCTAGTCAAACGAAAAGGACAGTCGCGCTGCACACCACAGAAGCAGAGTATATGGCGTTAAGCTTACTCGTTCAAGAAG
TCAtccatctccagcaaatGCTGAAAGAgttgaaggtgaagcagaAAATGCCCTCTGATGTGTTCGTGGATAACGAGAGTGCTCGAAAGCTGGCAAACAA
CCCCGAGTTACACAGCCGAACAAAACATATCCATCCATGTTCGCCATCATTTCTTTCGGGAACGTGTGGAATTAAAGCCGATTGTTGTGAAATGAATTGC
TGGAGTTGATAATGTGGCAGACGCGTTTACGAAGCCACTGCCACGAGTTAAGTTTGAGCAGCACAGAGCAAGCATGGCATTGATGCCCCAGAGTGAATAC
AACAAGACGGAGAGTCCACGCAACGATGACAACCAGTAGGTGGGGCTGTTGTGACGTACTGGTCCTCACGGTTgctactggagcagcttAGCTTTTGTCT
CGCCAGGTTTTATGCCGCAGTGCTTTTATCCTGCAGGGTTTTGCTAAACATATTACAGTTGGAGGGCACAAAAGCTGGGAAAGGTGAGAGAAGAAATGAG
GGAGGCAGAAACAGAAAACTCTACTACACAAAATACActcggcagcaacaagcagccTTCCTCACAGCCATCAAACCACCTTTGCATTCGACTTCGTCTG
TACTAGTTGAGTTACCAGCTCACGCTTAAACAGTCAAGTTACAAGTGAGCTCATACGCGGTCAAAAAG