Description :
From Genome Similarity Track
Location :
Scaffold_3092:1678- 3004
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3092-fgenesh-gene-0.0HECT ubiquitin ligase

Sequence
1326 bases(100 bases per row)
CGGACGACCTGCGTGACCACGATGTCAAGAAATCGTTCTGGGAGATTGTGAGAGAGATGCCGAACGAGTACCGTCGGCGACTGTTGCACTTCGCGACGGG
CTCGACTCGCGTGCCACTAGCGGGCTTCAGTGTCATGACGAACTTTGACGGCCAACTGAGTCCATTCACGCTGCATGGCGTGAAATTGAGCGAGAGCGAG
TACATCTGGAGCCACGCGTGCTTCAACCGTTTGGAGCTGCCGCTCTACGAGAGCCGTGGACTTGTGGAGAAGGCGCTGTACGCGGTGTTGGAGCTCGATT
TGTACGGCTTTTCGACAGAGTAGGTGTTTTTGCTGGGGTGTGCATTTGGAAACCAGTAGGGTTGTCATATGAATTCCTCGAACTGAATATTGATTTGAGA
GCCTCAGAGATAGGTTACCTGCCTGCTTTCAATTGATCCACGACAAAATCCGACAGTACAGTTTATCTCTTGAACAGAATGGTGATTTTGGTGCCTTCGA
GGTAGGTTACATGCTTGCTTCAAATAATCCACTAGAGTTGTAACTGCTGGAAGCTCGACTGGTGTCTGCACTGAAGCACCACACAAAACGCAGCTTGCGG
GGTTTTTGAGGTTCTCAAACTGGCTCACAATCGTGGAAGCCATTGCGAGTTTCGCTAGACAAATAGACAAATAAAGGTCAGCTGTCAGACTCGAGGTTCA
CCGCAATTCAAATTATCATGATAAAGGTGTGCGGCCATCTATGAAGCAGGGGTTGCCAGCGCATATTGTCGTTTTTTCTTCCACTTGCGGAGCCAGCAGC
CAATAAGACAGACGCCAACGACAATCGGGATCCCGACGAGCAGAGTAATCACGACGATGACACCGGTGCCGACCACCTGCGAGCCGTCCGGGCCCGACAT
GGTGGAGAGGTGACGAAAGTGGGTAAATGTTGTTGCGAAGATTGAGAATTGGGGAATGCACTTTATCACGGATGGCGCTGCAGGGAGTGGATTCGGTGCT
TGGCTTCGCTAAAAGACTCCTCAGCCTTCTGTCAATATCCAAGATCGCCCTCGTCCATCCATTTTGGTGGACAAAGGGGATGTTCGATCAGAATTTTGTG
TCAATCGATTTGAAAATCCTGTTCGAACATCCACTCAAAGTAGGACAATGCCACCGATACCCATCCAACTTCAACATCAAATTAATTAATTTAATTTTTT
CTAATTGAAATGCGCTTCTTATGATGAGACGTACCGCTGTAGAAATGAAAAAAAGACTGCTGTCACACGCCACATCGAGTGTCGCTGTTATGTATTACCA
CCGAGGGCGTAAAGCTGCTAAGATAT