Description :
From Genome Similarity Track
Location :
scaffold_221:16779- 17854
Transcript NameFunction/comments
g5877.t1 hypothetical protein PHYSODRAFT_492247

Sequence
1075 bases(100 bases per row)
TGCGGTGGAATTAAAGTTTTTTTTTACCACAAGTAGTAAATGATTTGAACTTCTTGGTTCTTTCGTGTCTAGAGCTGAATCAATAATCGCTTCTTGAAGT
ATCAGCGAACCAGTTTGGCACATTAACATGAACACAAGACGAAAGGTTCTGTAACAACATCCCTGTGCGCAAGATGGATTCCGTAGTTGATGCTCGCTCG
TTGCTAGGTCTGATAGTCAGAATCGAGATTTTCCCTCACGACTTGAACTGCTCAGTGATTCACGAAGGAAGCATACATGTTCGAAGAGAAATACGGCTAA
AAACAACATTAGCAAGCAAAACACTGTGGGAACCACCAAGCCAATTGTATTGTAGTCCGTCATAAGGAGCTTCTCTACAATTAGCAACGTTAACACAACT
ACAAAAGCTGGTAGCAGCAATATTCATAAATCTTTCTTCTCAGGAGTCACTTTCGGGGGCAAATGTAGGAACTGAATCGCTTCCACCAGCTCAACTCGTC
GAAGCTCTCCAAGTCCGCGTCCTCCGCAGCTAAGCAACCTGATTCTGACAACAAACGCAAGGGTCAGCACAGTCAAGCACAGTCCAACTTAACAGCAATT
TCACTCCGTACTGATAAGATGGCGCCTGGTTGCAGCCACACTCTTTCTGTACTTGTGTTGGCGTCGGATACGAGGTGGGGCCTCCAGCAGAAAGTAAGTG
CCACACGAGGTGACCAACGGTTCGAGCGGTTTGTCTGGGTCTAGCCTGTTGCCCTCGCTCATGATCTGCCTGAGGCCGTCTGATAGTTTGCCTTGGAAGA
GATCTTGACATTCAGGCTCGCTTTTATTTCAGTCGCTGGCCGTTCTTCCTTGCGAAGTAGAGGTTGAGTTCGTCTGGAGAGCAGTCCTACTTCGCTCTCA
CGATAATTTTGCCCAGGACTTCGCGCAGGACTTGGGCGCTTCGGTGTTCTCTATGTGCGGGTGCTGACAACTACGCAGTTGGCAGCGCTGGTGGAGCGCT
GGAAGCTGATGTACTACCGGCATGGGGCCGATCAGTGCACCGGAAGTGACTTGGCGGACGGGCTGCGTTGCAGGC