Description :
From Genome Similarity Track
Location :
contig_60:167715- 169868
Transcript NameFunction/comments
g9081.t1hypothetical protein

Sequence
2153 bases(100 bases per row)
CTTTTGGCTCGCGCAGACTCACATGCAGGTAGAGCATGTTGATAATCGCCTCGTGCTCGTCCTCGGTCTCAGCGTGTAGCTCATTGTCCACAGTCACTTC
ATGTGGAATGTCGCGTTGAAGTCCGCCGATGGCAGACGATGAACAGCCCACCGTTCCGAGCCAGACGCGAGCTAGCTTCGAGAGGAACGGGTACCGCTTG
CGGTTATCGCGCCACCACTTGAATGGATCCGTTATACGCGCCTCGCGCTTCTGATGCTTGGTCAGGTACGCAGACACCTCATCCGCCACGCACATCCGCG
TCTCCTCTATGCGAACATCGTCGAGAGGAGGCGCTGTCTCCTCCTGCAAAAGCGTGCGCATCAGTCCTTGTGCAGGAGTGTCCTCCCGGAATAAGTCAAC
AGTCTCCTTTACTAGCGCTAACTGGCATCGCTCTCGCTCGCTCTCGCCGACATGCTCCATCTTCGCGTAGCGTGGATCCAAAAGCGAGCACCACATCATC
TCCGACAGCAAATCGTCGAAATTCGCACGTAAGCTTTCGATGACGCTCTTTTGAAGCATTACGAGATCACGGCTAATCTCCGTCGCATCAAATCCGTACA
TCAACCGGTACTGCTTAATCAGACCATCCAGCACGTTTTCCTGGTTTAATTGGTGCTTGGAAATCACCAGGCAGTGGATCATGAACGGGAGAGTTCGAGC
TTTGTCGCTCGTGGTGATCACCTGAACTTCGCGCAATGTACGCAGTAGCAACAGGAGGGCTTCCGCTACAAACCACATCTTCGCAGTAGGCTCGGGGATG
TTGTGGGCCATTTCTTCATCGTTTTCAGTGTCCAGCGATGCAAAAAAACGATTGATAGAGGGTCTCCAGACCATCAACTCGGTCAACAAGTCATACACCT
GCTCCCATGAAGTGCAATCGGTTTTCCGAATTTTCAAGCTCTCGTCGTCCCCACCAGTGATCTGAGCGCGCAAAAGCGTCTGCTTCACTTCCCAATTATA
ATCCAACGCGTCTGCCAGTGCCCTCAGATCTGCAATCACCCCCCAAACGTTGGATTGGGCAGTCTGTTTGGACCTCACGCTTGTGCCAGCGTTTGGCGCC
GCAGTCGTAGCGTTGGGATTGCCGAGATCCCGAGGTCGCCATATCCAGCAAAGAAGGGAAGTATGAACCACTGCCCAAATGTCAGGAAAACGCTTAGCTT
CGAGGGCCGATGCAACGTGACAGCTTATCTTGTCGTTATTGCTCAGAAGAAGTGACAAGTTGTTCTTTGGGAGCTGCCACTCCCGTAGAATCGCCTTGAG
GTGCTCACCCAAAGCGTCCGCACCGCCGTCCTCTGGAAACGGCACGTAGACCACACCCAAGGGTAACGTCGCCGACTCGAAATTCGTGTTCATGTGGTGG
CACAGCAGTGCAAGGTACCTGAATCTCCCACCCCAATTCGAGTCGTAGTGCGTTTGCCAGATCTCTGCGGAGAGCGAGAAGTGGCCCACCTCCTTCTGAA
CCTGCACCATGGTTTTAAAACGGAGATCTGCCGCCTTCTGCTCCACTATGCGGCACATAGTTGTTCGATCTGGTACCGTTGCTTTTCCTTGCGAGAGGAA
CTGGATCAAGCGATCGAAGCTCGCGTCGGTCACCACCGACAACGGTTGGAAGCTGCAGCACACCCACTTGATCATCAGGTGCATGGCTGTCGGGTCTCCA
TAGTACTCGCGTCGGGACATCTCAGGCCGTACCTTCGACGCCGTCCGGCCCTTTTTGGGCGCAGGTCCCTGATTATCGCTTGGCTCCATGGAGATGTCTT
CACCCCCCGACGATTCGGACGACGAGCGCTTCCCATTGCGCTGAGCTTGTTCCGTTGTGGCTGGAGCCTTCTCTTCAGTCTCTCGCATTGCCAGATAATT
CTTGAGCTCTCGCGGGTGCAGCTTTTGCATGTGGTTACGCACCGAATTGCTCGATCCTTTCCGAAAAGAGAAGGCCTCTTTGCACTGCAGACAATAGGCC
TCCGTGACGTCGTCGGTACTCCATCTTGTCTGGCCAGCGGGGAGAGTGCGGCCAGGGGGCGCCACGAGCTTGATGAACTGCCAGTACTCGGGGCGCCGGA
TGCGCGGACACTTAAAGAGCGTCAGGCCGCGGTGGTCCAAGGAGTTGCTCATG