Description :
From Genome Similarity Track
Location :
Scaffold_3:1677100- 1679937
Sequence
2837 bases(100 bases per row)
CGCATAGCTCCGCCTCGTTTTTTTCACCGATATAGGATTTGCAGAGGTTTAATGAAGTGCCCTACAAAAGAAAAGGATCCAGGTCTGAAGTCTCAAATGC
AGAGGGTAGTAGCGAGGGCTGGTGCTGGGGTATCAGCTGCGGTGGGGAGGGACGTTGCCCAGCACAACTAACCGGACGAGGTTGGGCAACACGAAGCTGC
TCTGCGTAGATCTGCTCTACAGAGAGCATTGCGATTGCTGAGTGAGCGCTGAAGAGGATCTCGGCATCACACATCAGAGTGGTGGGGAGTTGGCCAGCAT
TGATCAGCTTGTCCTTGTGCATGTGCGTGAGCCGGTAGTTGTTGCGCCCTTCGTTGGTCATGATCTCCTTCATGACAAGTTGCAGCGTTAAGAATGTCTT
GTTGAGAGTTTCTGCCGTAGTCTCTGCAAACAACTTCCTTGATGAGATCCTCCGTGGTCCGTGGGCTGGTGTGAGACTGGAGAGACTGTATGCTGCAGAA
GTAGCCGAGACCCAGGCAATTGAGATCTAGGCTTTGGGCAGGTTGGTTCTTGAGTCGGATATTCCATCCGTCGGCGCGTCCAGCAGCGAGCACTTCAGCG
TCCTCCTCAAGCACATGTGGCCTCGCGTTGTCTTGTTGAATGCGAATGAGAGTGGCCTTCTGATCTTGAGGCCACTTCGCCTTGATGGCAGGAATGACGT
CGGTCACGAGCATGCGGCGCGCCAAGGTACGGTTCATAGAGACTGGTTTTATCTCCTCGACACCTGCGGGGCGGTTGACACTCCAGCGTTGTGTAATGTA
GGTTTCCACGACAGGTCAAAGCCCTATCTTGCCGTCCCAGTCGCCGCGTGGCCGCGCCACGGCGCACAGGAACATCACCTTCTTGATGTGACGCTTACTT
TGAACGTACTGCAGGGGGGCTTCTTCCAGGGGTGTGCCGTCCTTGCCTGTCAGCACGTACACACGCTGGCCGATCTTTTTGACGTAGAACCACTTCTCGT
CAATGTGGACTACGTCGAACATTGGGTCGAAATAGTACTGCCCGTCTCCGTTTAGCTTCACGTGGTTCACGGCGAACTTCATGCGTGCCACCCTATGCGA
TGCCGTAAGCAGGGACCGTGTGTGCCTCAGGGCCCGCCTCATGTAGCCCTCCTTGATCAACTGTTGGACAAGGTAGGAACTTGTATTCGACGCCTGTTGG
ATCTTGCGGTGGTTCTCACGCTCGTTGACGGGCACGGCTGACACATGCTCGCAGAGGACTGCTCGGTCTAGCATCTTTCTGCCACGCGCACTCTTTCTTG
ACTTGACAACTGCAGCGACGCGGTCGCCCATCGAACTAATCCCTCTCTCCCAAATGCGCGCGACGACGAAACGACTTAAGTGAAAGTGTGCTGCAGTCTG
GACAATGTCCCCAGGGCTCAGCACACCTCTCGTGCTGCGAAGGAGCAGCGTCTCCCAAACGGCTTGCCGTTCTTCATCGGTTGCTTGCATCATGGGCAGG
AGAGTGCGTCTTGAGCAGGAGGCTGCGTCTTGAGCGGGAGGCTGTAGATCTTCGAATGAGCACTAGAGGAAGTTGTGCGGTCCAGAAAAATGGGCAGGAG
ATTCGCAATTCAAACGATCGGATTTACAAGGGTATCGTTCTGAACAGGATGCAATCTGATTGGCTAGGTGCGTTATTTTCCGCTCAGAGGTAGTACGAAC
TTTATTTTCGAAAAGTAATCAACTTTTTGAAAATAAAACTCGTCTGGGAAAACAATAAGACTTTGTACTCCGAGTCGGAATAATACATATATATTTTACT
GTATTGAAGCGAAGCCCAGATCTTAATTAAACTTTCTTAAATTTCTTGAGTTTGCTGTCAACGAAGCACATGCTAATGCGAAAAACTGAAAACAAAAACT
CGTTTTTTGTGTATAAGGACTTAAGTATTGCGCCTTGCAGTCACGTCACTAGTATTTTGCTGGTAGGAAATTCGGACTTCAAGTCAAATCCAGATTTACG
CGCACCAACATTCGCATTATCATGGCGCTATCTAAGTAGTCTCATGGTATGTGGGGTATATTTTTTATTTTTGAAAAAAACAAAAAGCTTCTTCATAATA
ATACCGTACCCCACAGAAATAAGTCTTCCTCGTTTAGAACTCAATTTGCCGGTAAAATGCTCCCAAAGTGTTGCCTTCTTGCTAATATTATTAAGAAAGG
TTAACGCCTTGTGAACGCATAATTTAATGACCGGCTTTCGGTGTAAACTTTATCTAGTAGACATTTTAGATTCCCCTAAACTCGACCTCAAAAGTAAATC
ACAGTAAAAAATGTTGGCACGGTGCCCATCCTGGGAGTAATTTTATGTTTTGAACACAAGTCAGATATGGTCATCAGGTCCGATATTTCATGGTATGGAT
GAATATCGTGACGGTGCCGACACATATGATTTTATACTTAGCCATTGTATGGCCGTCATGGTCCAATCAAATGTCCATGAGCGATTATTGTCGAATGAGG
AGGCGGATGAAGCGTATTTTATCCAATCATCAGCGCTAGGGGTATGTTTATGGACTGCCGACACTCCTGCCGACGTATAATGTCGGCAAGGCTGTCGAAA
TATGCTATCCACCAATAGTGAGGTTAAGTAATTAGGCGATTATATACATATTTTGCTTTCTGCCGACACTTCACATTGCGTTTGTTTGCCTGTTGGAAGC
GTTCTGTATGGCGCCTTCACTTACATCACAGATTCAATCGAGTTTTCTCGGCAATGCCGTACCCGCATGCGAGCATGACACAAAGTAACTTCGGGTAAGG
CGCTTCTGAGATGCCGCCAGCGACACATGCGTGACTG