Description :
From Genome Similarity Track
Location :
Scaffold_452:1677- 3483
Sequence
1806 bases(100 bases per row)
CACTTCGTCTAGTCGGCTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTTAAGCGGCGCTGGTCAAGCTA
TCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCG
GGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCCCCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAA
ACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGT
ATCGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCT
GGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTACCAGGATCTC
GTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGC
CAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCTTTAGCAGGTTGTAATTGAGATCCAGTACGCGCAGAAGCGCGAGTATCTCTTTCT
CCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGATGAAAGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAAAGCTGCTGAGAC
TGCCCAGTCGCTGGCATAAACTACCACCGTAGGTTGACGTTCCGGATCAAAATGCCGAAGGATAGGTGTGGTTGCGATCCTGCTCCTTAGCTCCACGAAT
GCGTGTTGAGCTCGGATCCACCGGGATTCCGCCTCTTCCGAGCTCTGATCCGTCGTCTCTCTCCTGATTGGATTCTTTTGGCCCCGGGGTGGATCCAGCT
CCTGTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGCGGATCCGACATCTCCAGGGCCAGAGCTTGTTGGATTTGGATCCGGAGAGCTGG
GGTGGTCATCGCAGCGAAAGCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAATTCAAACTGCCC
AAGAAGGATTGCATCGCCCGTAGCGACTGTGGGAAGGACAAGTCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCATCCTTGGAGACTCGAT
GGCCTAAGTAATCCACCTTGCGTATCCCCCAATAGCTCTTCACCACACTGATAGAGAGGTTCCACTTAGTACACGCCTCCAGTAAGGAGGTTACTCTTTC
GCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATATAAGATCTGCGTCCTAGCACAGACGGGGTCCCAGGATCCCCTGGTTCCCCCGCT
TCGAATGGATCCACTTCCGCATGATCTTTCCCGGATCCACCCTTTTCGGGTTCCGGTATCCGGGTGAATCCATAAAGGGCGTTATCGATCAGGCGTTGGT
AGATCTGGGGTGCGTTCTTCAAACCAACCGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCAT
AGTAAC