Description :
From Genome Similarity Track
Location :
Scaffold_2350:1677- 3191
Sequence
1514 bases(100 bases per row)
TTGAGGGGCCGGCGGAGAATTGGAGACTGAGCTGCAACGAGTTGGGCCTCTCAATCTCTTCTCCGGCCCCTGCTCAATAAGCTGAGCAACTAGCGAAGTT
CTCAGGCAAAGCTCAGCGGAGCCCAGTGAGCGTAGCAAACGAGGTTGAACGGGTTGCAGCAGGGACTTCCCGGGCGAGAGCGCGGCCGGAAGGCGACGTC
AGAAGGCGATGCGCCTATGAGAGCGCACAGATCCGCAGCACCGCACCTTCTAGGAGCACTGTTAAACGCTCACGCACCGGCACTCACGTCAAAACACCGG
GTTTTGTTCAGTCAAATCAGTCAAGTTGACAACGTCAACCGATTTAAATCCGAGCAGAGGCACCTTGCCACTTCAAAGTACATGAACAACAGCTTACATA
GATACTTGTGCGTGGTCCTTTAACTAAGTGCATCCGATGTAGCTTAGCCCACGCAGATTTCTGTAGCAGGGTTTCTTCCAACTTTGCTCACTGCGATCGT
ATCGCACGGAGCGGTAAGATGCACGTAATGCGCATCCTCGGCCGAGCGCTTGATCATCGTTGCGTTGCGACTCGAGTGGATCGAAACATGTAGCAATGCG
CTCCTGTACTGTAAGCTTGCAAGTCGTTTTGGTCGCAGAGGCTGGTAGATTGGCGCCGTGTCATGGAAGTGTAGGTGCTGCCGAGCACGCGCAACTTCAA
ACTCaaacttcgacttcgacatCGTGGTGACTTCGTGCAGGGTCTTTTTTGTCTGCACTGACCAAGGCAGAACAAATGGCATTTTTTCCGCTGGTCTAAA
GCATTCAGGCGACATTGTGGAACAAGCTCTTGCCACCGGTGAAACTTGCACGTGTACCAGTATACTTGGAGCACCAGGCACGCGCGCGTTCCGGCGTACG
GTGGCATCGAGTTTGTATCATACAAGGCTTGGAGAGGAAAGTCTCCGCTAATGGCCGTGGTCTCAGCTGGTGACAAGCTGCGCGACGGCAAGCACCGATT
GGCGTTCCGCAGAGAGCATTTCCCGGCAAAACCAGCCGCGGAGAGCATCAACGCACATGCACAGCACAAACCGGATCTCGAAGTGGCTGCGCGCATCACC
TGGGGTCCCAAAAGGCTGGGATGGGAGCCCAGCCGCAGCACCGGACGCGAGACATACCCATGCCATCGCACCAGAACGAGATGCGCCAACTTCAGAAACG
CCGCAGagctcgcccagcagcgcccgcttgtcctgcagcattTCCCCCAGAAGCAACCAAAAGCGCTGAAGACAAcgagcgactcggagtcgTGTTGAAC
ACGTCGTGCATGTTTGTTCAACATAAAGATATATACGGAGGCGAGCGCGGCTATGTTGATCAGCAAAAAGAGCTGCACTGGGAGATGGGTTACACCCGCC
GAGGATGCTGTCGTCCTGCAGATCAACTGCAACGATCTCTGTTTGAAGTTGTAACTTTCGTCGCCAAAGTCTGGTACGTTTTCGTGCGCTCAAAATTGTC
GAGTCGCTTGCAGC