Description :
From Genome Similarity Track
Location :
Scaffold_442:1677- 3112
Transcript NameFunction/comments
Phyke_g9543hypothetical protein PHYSODRAFT_419340

Sequence
1435 bases(100 bases per row)
ATATGTTTTCGTTTGGTGTCGTGCTGTCTGAGCTAGATATTCACACCTTATCGTACACACAGGCCAAacagcagatccagcgcACACACGGCCGCCACAT
GACAGATGCAACCTTTCCCCAACAAGTGGCGATGGGATCGGTGAACGTTGAGTTTTCAAATATTGGTCCACAGTCCATGATGGAACTTGGTTGCGCGTAC
GTGTCATTGGACCCGAGCAAGCGTCCAAGCGCGCTGAGGCCTTATTTAAACTTCAGTTAATCTTGTCGAATGTGCAATCGGAGCCATTCAAGGTCGTTAC
CGCGGACTTGGCGCTGACTTAAGGCGCGATCAGCAACACTCGAATTGCATAAGAATACTCGGTAATGAAGCATAATTCAATCCAGaggaacttcttcacg
tctTGCAATGTTCGCTTCTTGTTTTCTACATGACTTCAAGAATGTTTCTCTTTCTCTGTTCCGTAATACGCCGTCCTATAGCATTTGGTACTGCAACATG
GGATCGCTCTTTGCTTTTCTTGCCGTCGCCGGGAAACAGGGTTGTAGCGTGTTTTATTAGCTTTTAATACAATTGATCCTCGTCATCAGCTTTGTTGCGG
AAGTAGACTTGTCGGAGaacaggaggagctgcaaatgTAAAAATGTTCGAGAGCACATGCTGGTCCAAGTCTCCGGAAGCAGTTAGGGACTGCGACGACC
CACATCTTATTTTCTTGTTTGCGTCTTCAGCCTTGGATTTGGAGGAGAGAACGCTCAGGGACGCGATTTTGGCTTCCATAGGGAATTTTGATCGTGCTCG
ATTGATTGGAGTGAGGTGGCGCTTCTTGAAGTCGCCGATATGCCTGGTATACTCAGGtgggacgacgacgtcggGAGATTCCAACTCTCGGTTGATCGCA
AGCATATGTAGGAGCGCCTCTAGGTCAGTTTTGATGCGGGGTTGATACCGGGTGCCTGAAATGCTGTCCCAACCAGCCCGTAGCTTGGTGAAACGGACAC
GCAACCAACGGAAACACTTCGTAACTTTGTTGTTCGTGTTACTCAAGTCCTTTGAGAGTTCTAACACATCGTTCCAATTGCCATTTAGAGTAGGCAATGG
TTTATCACGTGCATGATAATCGCTGAAGTCGAGCCGTGCATCTACCACACCACCTCCGCAGAGCAATAGTTCGTGCAAGTTGGGGCAGTGCCGAAGAACA
AAATTTTCATGCAACTCCACCCCCACACTATCAAGTGTCAACATTTTTGATGAAATCCCGATCTCTTCTAGGAAACGGGGGAGTCCCTCCTGGTTCGATC
CTCCAAACTTGCCGAATCCGATTCTGAGCGAAATTAGCCGACTTGGTTTAGTTTTCGTTGCGCTAGTTTCTTCGAATTCCAGATCAACCCGCTGGACTTA
ACATCTGCCAAAGCCAGGAACCATCATATCGACCC