Description :
From Genome Similarity Track
Location :
Scaffold_2610:1677- 2837
Sequence
1160 bases(100 bases per row)
GACATCATCTTGCAACCGTCTGTGATCTCCATTGTCCCACGAAAGTTCCAGATCCACTGCATCCCTCATCCCTGTACCCTGGATCCAGGTCCTTCTATGC
GGGATCCTCCCTCCCTGGACCCGAACTCGGAAGTATGAGATCCGGGGTACCTCGCGGTGGATATTGACTTCTCGCTAGCCGTGACTACTAGATCCACCTT
CGGATGGCACCTACCACCATTCCTTCATAGGATCCACACTCGATCCACTGGTACATAGTATATCCCATATCCACCTAAGTGAATCCAGGTAATGGTGGAT
CCGAGATAAGTCTTGGTGGATCTTGCCTTCCCGTACATCGCTCATACCAGATCCATCGTCATTCCATACGGGGTGTTGCTCGTCATGGCTAATCCACCAC
AGGCAACTTGCATCCGTGCCAGACAATCCAAATCCTCTATAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGCCCATTCTCTTAT
TTCGGAGAAAGCACTTCATCACAATCGCCTCCTGTACGTGGTCGGCGCTGCACAACAGCGCTCACGACGTGCACTACCAGCATCCACAACCGCTTCCTCC
TCTACGTGGCACATGTCCCCCACCAAGCGTACCAGCAAATCGCCGGGCAAGGCCCCATCCACCACTCCTCCGGTCAGCCCTTCCTCAATGTCACCCACCG
ATCTGCGGGCTCTAGCCCAGGCTCTTTCCGATCGGGTGCAAACCTTGACGGCAGAGCCCCAGACGGCCCAAGATGCTCGCGACCAAGCTGCGTCTTTGCA
CGCCACCCAGCTCCACACCTTGCGAGCCCAGGTCCATGACCAGGCTATGGAGATCCAGGGGTGGGAGCACCGTGCGGCCTCTCGTTCGCAGGACCTGCGA
CTCTTGTTGGCTGATCAAGCGGTCGAGATCCGCGACTTGACTGGACAGCTGGATCGCGCCTCCCGTCAGCGAGATAGCATGCGAGACGACAACGACCACC
TCCTTGGGGAGATGGCGCTCGCCGGATCCGAGATCCACCAGCTCCAATTTCGGATCCATGACCTCGAGCAGGATCTGGAGAATTCTCAGGCTGCTAGTGC
AGCCGCGGACGAGAGCTTGGATCGACTCCGTGACGAGTTGCGCCTGACCCAAGAAGAGTG