Description :
From Genome Similarity Track
Location :
scaffold_13:167669- 169848
Sequence
2179 bases(100 bases per row)
TCCTCCCTCACTTACGTCAGAGGTAccacccatcgcacaaagcggtaTTTGCAGGTGTCGTAAGCCATTTATTGAAAATAACGCAAACCAGCGGATGAAC
GAACCAAATTGTTCATAGCGAACTCAACCAATGGATACCACAAATTCTATTCTGCGGAATATTTCGCAAAGACGTTTCTCCACACACCGCCAACCACTTG
GTTGGTATGCTCTGTTTGCCAGGCGGTCTCCGGGTGTACCACGTGGACATATCCAAGCGAGTGCCTGAAACTCAAGACAATTTTTTCACAAACCATTTGT
GAATCGTGTATCACGACCAGAGACGATGGCTTCTGGCAATCAGTGATTGCGAAAACGTGAGCAATGAACAATCTGGCCTGACCTACAGAAGTGATGGATT
CGCTTCACGGAGCGATGCGAACCATCTAGCTGAGAATTTTGACGAAGACGAGTATTCCATTGTGACCATCAGCATTCTCGGGGGAATTTAAGACAAAGTC
GAGATCGACTGACTCTCAACAGTCAGTAGGAACAGGGAGAATCTGCAGTGACAATTTCACGCGCTGACAGACATCATATGTCTTCACGTATTGTGTCGCC
CACTTGCACATGCGGGACCACCAAAACTGGGCATGAAAATTTGGAAGGTAGAAGGGTATTTTCACAACCAAAGTGACTGGCATATTATGCGCCTCGTACT
CAAGtggtgcttcaaatcatGGTTGGGGAAACCACAATCCGTAACTCGTCGCCATGTGCAAATTCATAGTAAAGGGGGGCATCTCTCAATGCATAATGAT
GTATCCGTGAGATCAAGCGACCAGCAAGCTTGTCATAGAGCTCCATATCACTCGATGAGATTGCTTTAATGATTGGATCACACTGTTTATTATTAACATA
CGCTCGACGTATCCTATCGAATACATCGCTGTCAATATGGCTAATATTTGCTAGCTCATAACGTggacgacgtgacaatgcTTCAGCCAGTACGTCCCTT
TTTGCTGGTAAAGGCAACCGTGATATTGTATTCTGCAAAAAATCACACCCATCGAGCCATCCACTGTGACAAGTGAGGAGACTAAATGCATATCGCAAAT
TTGCGTGATTCGTGTAGACGACAGACGGAGTTATTTCCAAAAGGCGAACACGAACCTTAACTAGAGAATACTTCATTGCCATAATCTCCTTGTCCTGGAC
AACGTAGTTTTTTCTGCTGGCTTCAGCTGTCGTGATTGACATAACACGACACGATCGCGTCCTTCTAAGCCCTTTGCAATAGCGCTCACAAACCCCGAAG
CCGCTATAAGGCCTTGTATCATCTGGTAAAGCACATAGTGGTGTTTCCATCCAGCTTCTTGATAAAAGTGAATACCTCTTTACAAGTGGATGACCACTCC
CATGGATCGTCCTCTTCTGCAAGTAATTGGACAGAACAGTCCATTTCCTCAAATCCTTATGACCTCGTGGTATTTGCCAATCCACAATTGCTTTAACGTT
CTCAGAGTCTGCACGAAAACCGTGTTTACTAGCATAACAACCGATTATTGGAACTTTGTAAGCACCGAAATTACACTTTGCAAGACTCGCTTGCAATGAA
GGTTCACGCATACATTCTAGCAAAGCACAGAGGTGGTCCAAGTGCACTTCTTCCCCAGATCTGCCATCTTCGCCTTTCGAATGGTCAAAAATGTTGTCAC
TATAGGTTGTGCGAAGTGTTACGGTGGTCGCAACAGATGGAAATCAATCCATTAAGGTTACTGGTACACTGAATAAATCTTGTGGCATCACGAGCCACTT
CAATAAGATGCCAAACGGTAAGGAACACCCTCCTTTCTAATTAAAATTTGAATATGTATAACAACCAGATCAAGACACTTTGCTGTGTACAGCCGGATAT
ATGATGATTGATAATTTCCTTATGCGAAATCGGAATTTGCGCAAGAATAGTCGGCACAATCAAATTGTTATAGGCGTAAACGATACTTCATTTACTATTT
GGTTGACGTACACAAAACGTCGATGTGCTGTGAGGGGACTCGCTCTTCCTCACGaaaccagcagcttgcttttgagcaaagaacACATCGATATAATCAC
ATTGCTCACGCGACAATGGCCACTGTCGAAGAACTGCATGCTTTAAACCAGGTTCACGATCAATTTCGCGTCGAATTCC