Description :
From Genome Similarity Track
Location :
Scaffold_275:16766- 18764
Transcript NameFunction/comments
Physo_144831hypothetical protein

Sequence
1998 bases(100 bases per row)
TGAATACTGACGCAACAGAGGTTGAAGCATTCCCCGGTCAAGCTACTGAAGACGCACTACCGACTAAAGCCCAGGTAACCGTTGTGGCCAAGAATGAGAA
AAAGCAAGCCTTAACGGAGTCGAAGCGGCGTGAACCAGGGCAAACACCAGCTCGGCCAGCTCGTCCCGTTAAAAACGCGAGCCGAGCTACAACACAACCG
TCTCCACCTATAAAGCCGACACGCCCAGCAACGAATCGAACACCGGCCCCTCCTTCAGCACCGCACCCTTTATCGGCAACAGATAAAAAGCCCACCACTA
CACCGCGGTCGTCTCGTACCAGGTTAAAGCCCTCCACGGTTGATCACCAGGTATCACTAACGAATCCAGCCGAATACAATACGGAAAGTAAAACTGCAAC
AACGAGTGATCAAGCGCCACAGACACAGGTAAGCCCCTCTAAACGGAGGCCAAAGGTCTCGTCGCCGCGGTCTCCTTCAAAACCCCCTTCTGCGTCATAC
CAATACCTGCCTAACGAGTATCCGCAACTCCCTCGGAAAGCACCCGTACCAAGACAGAAGGCTAAGCCCTCCACCAGCGGAGAACACGGAGGCAAACGCC
GGTTGCTTCAGCCTGTGAGGACGCCCGCCAACCTGCGCTTCGACCTCCCGAAGATGGACAAGACAAAACGCGACTGGCTGTTTGCCAACATGTTCCGCCA
CGGCGACGACCTGACCAAATACGAGTCGTTTGTGCCGCCGACACTGCGGGCCAGACCCCCGACGTCCAGCAACCTGAAGGAGACCAAGAAGCGGCCGCTG
TCAGCCAGGCAAGTGTATGGGGATCCGCAGCCATTCCGATTTGTGTCGCCTAGTCGGAGACTCGTCCAGCAACCGAACCCTGCGCTTCAGGACCGAGAGC
GTAACTGGGTGCCCACGACGCCCCACGACTCGAAGCTCCCGCCGTACGACTCCATCCTGGACAAATACTGCACCACAGTCACGAGTCCTGTGGTCCAGCG
CCAGATCTACCAGACTAGGCACCGAGACCTGTCCCCCCAGTTGGCCTTTGTGCTGGAGAAGCGCGTTGAGAAGCACTGCCGCAAGGGCTTCTACGACTCG
TTCGGCGGGGTCAGCTCGTCCTACAAGACTGAGATTGTGCCGACATCGCCTGTAGACGGATCGAGGCAGCGACAAACGTCCCCGCGGTCCCCAACCAAGT
CGGAGATGCTACCAACAACAAGCCCCACCTCGGCCCCCGAGGATAAGTTGTAATGGACTGAAGTTGAAGTGAACAACCAATCGGATTGATTCGTTTTTGT
GCTACCAGGTAGACATTTGCCAAGATTACTACAGCTGTTTGGCGAACTGAACTGTACAGTCTGTACACATCGCGTTAATCGCCGTTGAGCAGCCTGACTA
AAGCAACCTGGACAGCTCAGCAGCTCGCCACGAGAGTCGATGGCAGTCAATGGCAGGAAGAACGCTGCAGACTGCAGCCTGCAGTACCAGGGCGGCTTGA
CTGAGAATAGTAGTCTGCGATGCACTTTAAGAAATGGCTGCGGATAGTCCGCGAAGTGACCACCGTGGATGGGGCGAAGACGGGCGAGGGGCAACAGGAC
CCGCGCTGGCCATTTCAGCTGGGTGCTTGCAATGCTCGAGCTGACTTGCCCGAAGATGGCACCACAAGAATGCCTCTGGCAGCGAGCGGTGCTGCAATGC
CTGCCAAGTCGCCGCTCGCATGATCTCTGCACGATAACTCCCTTAAGTTTACACACAACGGCGGCTCAGCCAGGTAAGCCAAGCTCGACTACTGGTAAGT
TTGACCAAGCAGAATTTTCCTGCATCGGCACCGCCAGGCTCAAGAAAAAGCGGGTCAATGCCATTGCTGCCGACGGACCCGGTGCCAACACAGCTAATAC
CGGTCACGGTATGATTCATGAGGCGCATTAGGCCTCGAGCGGCTCGAGGCTCGAGTCGAGCCATTGCATTACCCGAGCTGACGTGACCCAATGCGACT