Description :
From Genome Similarity Track
Location :
contig_113:16763- 19257
Transcript NameFunction/comments
g11258.t1hypothetical protein

Sequence
2494 bases(100 bases per row)
CCACGCTTGTCGGCGTTCTCCTTCTGCTTATCCACTGCTTCTTGCAGTGCATCTCGTGCAAATCGGGTGACCGATTGTCGCTGCAGCACGAACTCAGAGA
CGGCCGCATCATCGACTGGACGCGCCGGAGGCTTCGGCGCGTAGTTAGCTGCGACGGGATCGGTAGCCGGGCCAGGGTTGATTAACGTGCGCGCAGTCCA
ATCTGTCAGTGAACACACCGCGTTGTTCGGCGTCGCAAGGGTCCGTCTCGACTTCGCGCGGGTGACTGCATTCAGCGTCACGGACTGGTGGGCTGCACTC
GACAAGGGAGCTGGTGGTTGTGGTGTGCCATCCGTGCTCACCACTGGTAATACCGGTATCAGTATCGGTGTGTCTGTGTTCGTACTACCAGCACCATCAT
TTCCTTCCCCACCCAGAGTGGAGCCACGAGGCATCGTGGGGAGGCCCACGGCGAGCAGAGCGGGAACGCGCGGGTGCCGCGCGTTATTTACAAAAAAGGG
GGTCAGACCCGTCGATGCGTGTTCTGCGTTGTTTAGCGCAAACTCGGCAAGCGGCAAAAAGGAGCTCCAACTAGTGAACGAAGTCGCGTAACTTCGAAGG
ACATCTTCGAGGACTCGGTTGACCCGCTCCGTTTGACCATCCGTCTCCGGATGCGCCGCCGTTGACATGAGCAGCTTCGTTCCCAGAAGTTGGAAGAGAC
TCGACCAGAATGCCGACGTGAACCGCGGATCGCGGTCAGAGACGATCGATTCAGGTAAGCCGTGGTGTCGAAAGACCGCGTCAACGAAATGCACCGCGGA
CTCAGCCGCGGTGATCGTGTCGGACACCGGAATGAGATGCACCATCTTGCTGAACCTATCCACAAACACCAAGACGCCAGTCCGACCGTCGGCATCGGGT
GGAAGCCCGAAGATGAAGTCCATCGACACTGAGCGCCACGCCTCAGTTGCAATCGGCAGGGGTCGCAGGGGAGCCTGCGACGACTTTGACGGCTTCACGC
GCTGGCAAATCTCACAAGTACGGACCCACTTGCGCACCCATTTGTACATGTGGGGCCAGTAGAAGTCGCGGGATACTGCCGCGAACGTCTTTTCGCGGCC
CAAGTGACCACCGACAGGGCTGTCGTGGAACTCGTGGATGATCCGAGCGCGCAGATCATCGTCGTTCGGGATGGCGATGCGGGGAGCATCGAATCGATCG
ATGCTGTACGTCAGCAGATCGCCGTCGAGTTGATATCGGTTAATCTGATTGCGCGTGTTGTTCGGCAGCGCGTGGAGTGTTTTATCACTGGGGGAAAGAA
GATGTGCGAGGATGGCGGCATATACCGCGTCGTCGTTGTACGCAACGGCAATTTCTTCGCGTAGCGGCATTTCTGGAGTCACGTTCATCAGGTTGACACC
TGATGTCAAGCACATCGCGCAGTGATCTTCGTCATCCTCGTCTTCGTCAATCACTTGACGACCCCGCGTCGCTCGTGGATCATAGTCTGGACTCCGAGAC
AGAGCATCGGCGAGGATATTGTTCTTGCCGGGCTTGTAGTGCACGACGAAGTTGTACTCAGCGAAGAACGACAGCCATCGTGCCATGCGTTGAGACAGAT
GTGGAGACTTCATCGCTGTGCGCAGCGATGCGTGATCCGTGTACACCGCGAACGTCTGTTCTCCGAGCAGGTACACTCTGAATTTGATCAGAGCGTATCG
CATCGCAAGAAGTTCCTTGTCGTGGACGGGATAGTTGCGTTCGGCCGGCTTCATCTGTCGTGATTGATAGCTCACGACTAGTTCGCGGCCTTCGTTGTCA
AACTGCGTGAGCGCGCACCCGATAGCAAAGTCGCTAGCGTCGCAGACGACGTGAAACGGTTTCGCGTCATCTGGGAGCATCAGTATTGGCGCCGAGGCCA
AGCTCTTCTTCACCGAGTCGAAGGCTACTTGATGCTCGGGGCCCACGACCACGTGGCGTCTTTCTTCAACAGCGACGACAGTGGCTGTATCAAGCCGGCA
TATCCCTTCGTATACTTGTGCAAGTAGTTAGCGAGGCCCAACCACTGACGCAGCTCAGTGGGGTTTGATGGTGGTGGCCACGAGCAAATAGACGACACTT
TTTCCGGGTCAGCACGGACTCCGTTTTTGCTTACGTAGCACCCAAGCACCGGAATTTCCGGCGCGCAGAAGACACACTTCTTGAGATTCGCGTAGAGCTT
GTTCTCTCTCATCACTTGAAAGACCTGCCTCAAGTGCCGCAGATGCACGTCGATCGCGCTGAGACCCTCTTCAGCGTGACTGTGCACAAAAATGTCATCG
AAGTAACTCGGAGCGAAGTCACGAAGCGGGCGTAGCACATGGGACACCATGCGATTAAATGTGGCTGGTGCGTTCTTCAGACCTTGGGGCATCACGAGCC
ACTCCCAGAGCATACCGCTGGGCGTACTGACTGCCGTGAGAGGTACATCGCTCTCTCTCATGAGGATCTGATAGAAGCCATCGGTCAAGTCGAT