Description :
From Genome Similarity Track
Location :
Scaffold_220:16763- 18148
Transcript NameFunction/comments
Aphas_H257_19293glycosyl hydrolase family 31

Sequence
1385 bases(100 bases per row)
CGGCTCACGCAACGCCGGTGTCCACCCCCAATCCTGCAGCCGCGAGTCCAGCTGCTGCAACACCCGCAAACGGCGCGTTCTGCCGTTGATATAGTCCACG
CAGACCCCGAGGGCGGATTTGTCCTGTTCGTGCAGCTTCAAGGTGCGGACGTCCTCCAAACGCACTTCGCGCATTCCGAGCGGTCCATTCTCGACCGCCA
TCTGCCCAACGCCTTCATCCTTGATCTTGATGTTTGGCGCTGCTTGCACCCCTGGCGCCGCTTGCCTAACCGGCGGCTCTTGCACCTGTACCACCGCGGG
TGTCCGCGCCTGCCGTTCCCGCTTGGTCTTCGGCAGCTTGCGCTGCCTGTGCTTCGGCCTCGGCTATTGACTCAGCCATTGACTCCTCGGCCGCCTGCTC
CATCTCCCGCTGGAGCCGCATGTCTTTCTTTCTGTGGCGCTCTTCCAAGGCCACGATCTCGTTTCGCAGGAGCTCCCGCACTGCCATGGGTCCCACCGTG
CGCAGCGCCGTTTTAACCAAGTCGGCCGTAGCCTGGTGCTCCGCATGGATCCGCTGCTCTTCCTTCTTCATGAACAGATAAAGCAGAGGATCTTCACTGC
CCGTCCAGAGCCGCTGGGCTCCCGCGAAGAAATACTCATCACTGTCTGAGTCGTCACCGGTCAAGTCCACGACCTCTTTGGCCTTCTTCCGTTGGTCGTC
GGCCATGCCGTCAAATTCAAGAATGACACCCAGTGAGCAAAGTTGACGATCGCCAGTTGGCAACGTCCAACGACCATCAACCACGCGCCAGTTGATTTGC
ATATTCCCATATTCTCGTTTGAGTGTGGGAGGGTGTCACAGTTCCGGATACAAGATCCGGATCCACGTGGCTGTACCACGGCACACAGGTTGAAGACAAA
GCCAGGCCCCAACCCACGAGCGGCCAACGACGCCGCTACGTGCCAAGGAAACAGCAAAGGGTTCGCCGCCCCTTTGCTTCGGACCACCCCCGGCCCTTTT
TGTTTACCAGCTCAAGATGGCTGGTCCTGCTTAGCTTAGTCATAGCGTTAGTGTCGCGGGGTTTTACGACAAGTTAATGGGTAGGCGCGGCGCAGGCAAA
CAAGGAGACTCAAACCCAGGTGTGGAGTTCGAGGCAAAATGTAAAGTCGAGTTAGTTAAAGGTGTGGTCGTAGCTGTAGTCCTAATGCTCTAAGTTCTAC
TGCATCGGCGGTTGACGGTTGAGGGATCTCCGTCTTGGTAGATCTTCGACACCCGGATGACGGTCCTGGTCATCGAGTTTGGGAGGTATATAAGGTCTGA
GAGGTCTAGCCAGAACGGGAAAGGCAACGCGGTCTTCAGGGAGGTCAGATGGTCGATCAGGGCCTCGTCTGGCTTCGCAGTCTCG