Description :
From Genome Similarity Track
Location :
Scaffold_24:16761- 17945
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11254hypothetical protein

Sequence
1184 bases(100 bases per row)
CGGGTGTTTCGCGCTCTCCATAGGTTAGTAGCTGGCGGCCAATGTCTTCGTACAGGATCATACGCGACTCGAGGTTCATAAGCACAGACGACTTAAGCTG
GTTCTTCGCACGAGCAAGCTCAATAGCATCGACAGGTCGGTTGGCAACACTGAGCATCTGGTTGCACAACAGCGCCACGAGGTTGCTGGTGTGCGACGGA
ATGCAAGCGCCGTAGATGCCAAGGAGACCCACGTCAGCGTGGATGGACGAGAACGCGAAGGCTGACTCAACCCAGTAGAAGCGGTTCAGAACGCTCGTGT
ACAACCGAGAGTACATACCCTTGCCAGGGCCACCAGCAGAGAAACTGTCACCACCGCCAAGCAGCGTGTGCAGCACACAGATCGGCACTAGGTCTTCGTC
GTGCCAGCCACCCGTAGGGAATGCCAGCGCCGCGTAGGAAAACTCCGACTCCGGGTTTGGGAGTGGGTACAGTCCTCCTGTGTAGATCACCGGCTCGAGT
GTCTCGGGACTCGAGGGAGTTGCCATGGGCGAATCAGCCGAAGCCACAGGCACGTTCGCAAAGAGTTTCTCCGCGCACTTGACCAGGCGAACGTGGTCCA
CACCGGAGCCAGCAAGGACCATCTTCTGAGCAACAAAGTGCTGGTCACGGAACTTCTTGACCTTCTCCACGGTCAGCGCGTCAATCTTGTCCAGTGGGCA
CTGCAGCGGTCGTCCGAGTGGCGTATCTGCGCCATATGCAGCGGCATGGATGAATTCCTGCAGCATGGCAGGTGGGTTCTCCATCAGGTCCTCCGTCTGG
ATGCGCATGATAGCCTTGATGCCCTCCATCTCCTCAGGCACTAAATCCACATTGAGGATGGCGTCGGCTAACAGCTCTAGACCCTTCTCCACGTTGTCGC
GCAGTAAGTCGATGGTGTAGATGATCTGTTCGCGTCCGCACGAGGACGTTGTGAGTGCGCCAATGTCTTCGATCTCGTGCACCAACTGCGCATGCGAGCG
TGACGTGGTGCTCTTAAAGCCAAGGTGTTCCAGAAGGTGGCTCACACCGATGCTGTCGTCGTCCTCAAAGCGGCTGCCGGCGTCAATGAAGATGCCGAGC
GTGGCAGCCTGACCATAAGTCTCCTGCGAAATGACGCGCAGACCCGAGGGCAGCACCGAAATCTCCGTCTGCGGAGGCTTGAGC