Description :
From Genome Similarity Track
Location :
Scaffold_387:1676- 3373
Transcript NameFunction/comments
Physo_125775predicted protein

Sequence
1697 bases(100 bases per row)
GAGGTGGGAGCTCGTCGGTGCGTATCCCGGTACGCCGTGAACACATCTTCGAGGATTCCTACTACGCGTTGCGCATGCGCAGCGGTACCGAGTTGCGGCG
AAAGCTGCACATTTCATTCACGGGTGAAGAAGGTATTGATGCTGGTGGAGTGACGCGAGAATGGTACATGATTCTGGCTCGTGAAATGTTCAACCCGAAC
TACGTGCTGTTCACATCAGCCGCCGATTCGCCTACTTTCCAGCCGAACCCGCTGTCTTACGTGAACAAGGACCACTTGAGCTACTTCGAGTTCGTCGGAA
AGGTGCTGGGCAAGGCCGTGGCAGACGGCCAACTTCTTGATGCTCACTTCACGAGATCGTTCTACAAGCACATCCTGCAGTTGCCGATTTCGTACCATGA
CATGGAAGCTATCGACCCGGAGTATTACCGTAACCTGCACTCAATCCTGGACAACTCGATTGTGGATCTTGGGCTGGAGCTGACGTTCTCGGCTGAGCAG
TCGAACTTCGGCAAGGTGGAGGTTGTTGATTTGATCCCTAACGGCAGGAATGTGGCCGTGACGGACGAGAACAAGATGGAGTATGTGAAGCTCGTGACGC
ACCATCGAATGGCGACTGGCATTCGACAGCAGATTGATGCGTTCCTCAAGGGTTTCCACCAGTTGGTGCCACCTGAGATGATCGCGATCTTTAACGAGAA
CGAGCTGGAGTTATTGATCTCAGGCATGCCCGAGATTGACATCGACGATCTGAAGGCCAACACGGAGTACGCCAACTACAAGCCCACAGATTCGGTTATC
CGCTGGTTTTGGAACGTCCTTTACTCGTTCACACACGAAGAGCGGGCACTGTTTTTGCAGTTCGTCACTGGTACGTCGAAGGTGCCGCTGGAAGGGTTCA
AGGCGCTTGAAGGCATGCGTGGCACGCAGAAGTTCAACATCCACAAGGCTTTCGGCAACAACAGTGCGCTGCCGTCCGCACATACATGGCAAGTCTTTTG
ATTGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGATGCGGTTCTTGACCGGGTGCGCATGAAGC
TGTGGCACCACGGCGACCTGGGGCTCTTCCGGGACGTAATCGACCCGAACTCTCGCGAGAGCGTTGTTGGGGGAGGACGGAGCCTCTACTTCTCCGAGTC
CGCGCCGAAGAAGGGCGGTCTCAAGCCCCCGATGAGCAACTCGTGGGAAGACGAGCTCTCTCCGAAGCACGAAAATGAGGACGAGGAGGTGACGATT