Description :
From Genome Similarity Track
Location :
Scaffold_227:1676- 3097
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_227-fgenesh-gene-0.0Glucose transporter

Sequence
1421 bases(100 bases per row)
CCTACGTGGATGCTTTACGCGAGTGTCTTCGTCGCGTGGATGCTCCCGTTCCAGTTCGGCTGGTCCATTTCCCAGGTCAACCTGTCCACGTTCGCCAACC
AGGACGATTGCGACGCGCGTCCGGTCGTCGACGGCACCTGCCTCATGTTCCCAGGCCACTCCAAGACCGAGTGGATCTTCGTCGTCAACTCGTGGATCGT
CGGCGGCATGGTCGGCAGTCTCACTTGCGGCAGCGTGGCGGACAAGATCGGCCGCAAGAAGGTGCTCATGACGAGCGCGCTGTTCATGATCGCTGGGGGT
GCCATCCAGGCAGCCTCAAACAGCGTTAGGGTGTTCGTCGCCGGTCGACTGGTCGCTGGCGTCGCGTCGGGTATTGCCACGGGCCTCGTCGGTGGCTACA
TCAACGAGATCGCGCCTCCACACCTCCGCAACTCGCTGGGCATCGGCCTCCAGATCTCGCTCTCCACCGGCATTTTGTTGGTTGTGTGTACGTTCTTCTT
CGCCAACACGAGCAGTGGCTGGCGCTACATTGCGGGCTTTCCTATCGTCTGGGGCGGTGTTGTCTTGGTTCTGGCGTCGTTCCTGCTCGTGGAGAGCCCG
GCGTGGCTTCTGAACAACGGCAAGCGCGACGAAGCTGCCAAGGTCATGGCGCAGCTCTACGGCGAGGAGCACGTGAATCTCGCGTTCTCGTGGCTCGAGC
CTCCAGCGAGCGCCTCGGACATCGAGACCCCACGCACCGGGTCGGGCGAGCACGGCATCGAGCACGTAGAGCTCCCAGTGGAAAGCACGCTCTCGCAGCT
CATCTCACCGCTGTTCCGCCGCCAGCTCATCGTGGCGATCGGCGTCGCGTCTGCGCAGCAGCTCTCCGGCGTCAACGCTGTGTTCTACTACTCGTCAAGC
TTCTTCCAGGACGCAGGCATCTCGGACGACCGCATCGGCAGTGTGATCGTCAACGCGATGAACCTGGTCCCGACGTTCTTTGTCGGCCACTTGGCGAGCC
GCTATGGCAACCGAAACATCCTGCTCTTCGGACTCGCAGGCATGTTTGTGAGCGCGGTCGGCATGACGGTGGCGCTCACGACGGGCGTCTCGGCGCTCTC
CATCGTGTTCACGGCCTTGTACGTGGGCTTTTTCGCGCTGAGCCTCGGGCCGCTGATCTACGTCGTGACGGCCGACCTCTTCCCAGACACGGTGCGCGCC
AGCGCGTGCTCGATCTGCATCTTCTTCAACTACCTCTCGAATCTGGTGGTCGGCGTGTCGTTCCCGTACATCGCAGACGCGCTGGATGACTTCTCGTTCC
TGCCATTCATCGTGATCCTCGCGCTCTTCTTGCTCTTCACGTTCAAGATGGTGCCGGAGACTGTGGGTAAGTCAAGCGACGAGATCCAGGCCGAGTTTCG
AGCGCTGCGCGAGACGAACGC