Description :
From Genome Similarity Track
Location :
Scaffold_20:167588- 168639
Transcript NameFunction/comments
Aphas_H257_09171unknown

Sequence
1051 bases(100 bases per row)
TTTCTGCAACGCTAGCTCCAGCCGCTTGACGAGGTCGTCCTTGAGGCCCTTGGTGTCGAGCCCACGGTCTTTCAGAGCCTTTCGCAGCTCCACCACTTTG
AGCTTGCTCGGGACAATCACTTCCTCCACGTCCTCGTCGTCGTCGTCATCCTTTCCTTCGATCGACAGGTCCACAGTGTCGCATACAGTTGCCACCACGT
CACAATGTTCTGTGGTTGCCTCGTCCGGAATAGCCGATGACGAGGTTGGCATGTGGTGCGCCTCCGGTGATGACAAGGCTGGTGCACGGCTCGGTGACGA
CACCACATCAACCAAAGCGGCACCATGTACTGGTGACGACGGCTCCTTCACTGGTGACAATGTATTCTTCACTGGTGACGATGGCTTGGTTGCTGGTGAT
GAGGGAGTTGCCTTCGGTGACGACACTTCGACGTCCGCCGAGGGTGCGGCAGTCGTGTGCGCACCTGTCACGTCGTCAAGTGTCCGAGTGGGCGGCGCGT
CGTCGTCCGCATCTACCTGGGAACTAGTGTCATCATGATGCTTATCGCTGAGTTTCGTGTCGACTGCAACAACAGCCGCCTCCAACGCGTCGAGCTTTCG
CTTCATGTCGAGCTCAATGTCACGCTTCTTGGCATCGATCTCCCGCCGCTCCACCTGAATCTTTTCTTCGATGGCTTCCGTGGATGCATCCACCAACGCT
TGTGTCTCCTTGGTGTGGCGCGCGGGGAGGTAGAAGATCGGGATCGGCGACACTGTCTGCAGGAATCGAGCCTGGTGCCGCTCCGTGCTGATGCTCAACG
CATGCTTCCGCTCGAGCTTGGCGATCTTGTCCGCCGCTGCCCGCTTGTACGACGCGATCTGCGACTCCACCTTTCGCCGCGCCGACCGCTGCTGCGTGAT
TGTGGATACCTTTTGGCTTTGCTGCTTTTCCTTGGCCTCGGCGGCGTTGAGGAGGCGGTCTTGCTTTTGTAACAAGTCGCTGTCTTGTGCGAGTTGCTTC
TTCGCGCGACCAAGATGGCCCATCAACGCACCAAACATGCGTCGACTTCGT