Description :
From Genome Similarity Track
Location :
Scaffold_46:16757- 17760
Transcript NameFunction/comments
g1937.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TACGGCTTCAATCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
ACCCACTGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGTGTCTTGGACAAACCGAATTACGGCTTGTCGG
CGCTGGACAAAGTCCATTGCATTCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTGGTTTA
AAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCTTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTG
CTTATCCGGTTGTTTTGAATTAACCGGATATCATCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTC
ACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAATTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGT
AGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGATGATCCGCAGTCGACATGGACAGCTGTGTCCCAAGAAG
TGTAAACACTTCTTGTCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCAACAAAC
AGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCT
TGT