Description :
From Genome Similarity Track
Location :
Scaffold_307:16747- 17959
Sequence
1212 bases(100 bases per row)
CCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAAGGATGACATCAAATTTTGTCATCCAAGTCTAATATGATGAAGTCATCATCGTATTG
GACTCCCTTTCAGTGTATAGGTAATACCCACTACACGTTTCATCACTGCTACGGATGCGCCTGTCGCGAAGTGCACCGTCATCCTCGTTGGAGAGATCTC
TCGCTCATATTCGAGCTCTCTGTTGTCTAGCGATCGGCTTCGTACAAAGTTGGTCGACGCCCCACAGTCGACTAGGGCTCGAAGCGACATGTTTTGTGTC
ACTTCGAGTTTCAAGGTAATGAGGGAAACCTCAATACCAGAAGCAGCAACACAATGACTGAGTATTGGGATCAACTTTCGTCAAGAGGCCTGCAAACTCA
CTTGACGTTGCTATTATTAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTGGATGTCCGTTTCGTTGTTGCGTCTTAGCAACAACGACGGACCC
ACGACTTAGACCTCTCTTGGCTGCTTGGCGGTTACTATTTCCTGCGGTACGTGGTACCGCGCTCGGGGCACTGCATTCATATGCATAATGCCCTGTCTTC
TGACATCTATTGCATTTTTGCAATTTCTTATAGTTGTTAACACGAGAGCTCTCGCTCCTCGTGTTACAGAGGTCCATTGGTTCTGGGTCTCCATTTTCCT
GTCGTCTCGACGAACGATAGAAATTCGAATTCGCGTGAGCCTGTTTCACGCTGAAGTCCTCCTGTTCCACAACCCTTATTGCCTCTTCTAGGGTGTTGAA
CTACAATCGGAACAGGTATGTTTTAACAGGACCATCAGTCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAA
GTGGTAAGGTAACGTATGTACTGAATGTACGAGTGTACGTCAAGTTTACCTTGCTTGATTCTCAGGAGTTCAGAGCGAGCCTTGAACTCAGCTCGCGGCG
GCTCAAGAGTTTGCCTTAGCAGTGACATGAAGACTTCCAACGACCCAAAGACATGGGTTATGTAACTTGAGGCCCAATGCCCACGTCTTTGCACGCCCTG
CGAAGTTCGATTGAGAAAATGCGATCTGCATTTCCTCATCGACGATATGACGAGCCCTTATGAAATCGTCTAGTTCCACGAACCATCTCAACAGAGAGTC
TTTATCCGCTCC