Description :
From Genome Similarity Track
Location :
Scaffold_71:167327- 173959
Transcript NameFunction/comments
Physo_139198ATGSL10 (GLUCAN SYNTHASE-LIKE 10); 1,3-beta-glucan synthase

Sequence
6632 bases(100 bases per row)
GACTTGGACCGAACACGGCTGATGTTCCGCTGTCGGGCGTTGCCAGGAGTCCGCGTGTTGCGACTTGCGCGCTCGGCACGCATGCGAGCCGCGCGATCAC
GGTCACGCTCAGCTTCAGCCTTGGTGCAGATGATGCCGTTTCTCTTGGTGCCCGCGCCCAGGATAAGTACCAGGGCGACCACACTGAAGCCTGCAATGGC
GTACAGGTACAGGTACTCCTTCTCCATCATCGTGTCGTGCGTGTGCATGTACACGTATCCAAGGTCGGCCATGAAGAAGATGGTGAACAGCATCGTCGTC
GAGGAGGCCCGGCCACGCGTGTTAAACATGCCGACACAGGCCGACCACGGGGCAGAACTCGTACCCAGACCCATGAAGAAGTACATGAGCATGACCACGA
GGCTGACGTACAAGCCCGATCCTTCCGTGTTGGCCAGGAACTGCGACGTCTCGTTGAAGCCCAGCACACCAGCGCAGATGGCCACGGGGATGAGCGTACC
GAACAGAACGGACTTGTGGTCCAGTTTGTCGATGAAGAAGAAGGCGATGACGGCTCCAGAGATCTGCAGCGCCATGGCGTTGACGAAGAGCTGATCCTGA
TCCGTGTACTCGCTGGCACCCTTGTAGCTGATGAAGGCGTTGAGGAAGCCAGTCGTCAGCGACGACACGAGCATCAGGAACAGGCCAATCAAGAACTTGA
AAGGACCCGAGCCACCATCGTCCGAAGTCTCCTCTTCACGCATGATCTTCAGCTCTTCCTGGACGTCCGGCTTACGACGCAGAATAACGAGGCAGGCCTC
GCACGCTTCCCAGCCCTTGCGGTCCAGGACCCAGTACGGACTTTCCGGGAACACGTTCACCACCGGAGTGACCAGCGCGATAACAATGCAGGCAGCAAAC
GTCTGCCAAATCCAGCCCAACTGGTTCACGGTAGCGAAAATACCGCCAAGCAAGCTACCAGCAATGAAACCCATGCCCAGCAGCAGAATGGCCTTACCAC
GCATCTCCTTCGTGGAGATTTCGAAGATGTAGATGGCAAGCGAAGGCAGCAGAATACCGCACGAAGCGCCGAGCAGACCAATACCAGGCATGAGCAGCGT
CTTACGCAGATCGTCGTTCGCGCTGACAGCCACCATGCCGAGGGTACTGAACAAGCCACCGGCAACGATGGCCAAGCGACGGCCGAGGAAGAAGTTCAGG
AAGCCTGAGATGATGGTACCAACAAAGCACGCACCGTACAGCATGTACGTCGTGGTGCCGTCGCCGACATTGCCACTGAGCACACCATCGTACGTCACCA
CGTAACTAGCAAAACTTGCGGACTGCTCCAGCGTAGACAGCAGATTGAACAGCCAGCCCACACCAACACCACCGAGAATACCCATGAAGGCCGCCAACGA
GAACGCATACTGCGACGAGGCCGACATGACCTTGGAGAAACCCTCATTGTACATCATACGCGTCTGGATGATGTTCAAGAACGGGATGCAGGACATAACG
ACCAACGGGATGATCATACCCGTGCAGAAAATGAAGTCGAACAGGAACTGCAGCTGCTGGAACACCGGGATGCCAGCAATCGACGAGCTCGGGAAGCTCC
ACATGCGGAAGCACTCGTTGATGCCGTACAGCGCAGCGACGTACGCGAAGAAGAGCGAAAGTGAGTACTTGAACTTCCAGTCCATCACGATCCAAGCAGC
GAGGAAGTAAGCGGTGACCAAGCCGGCCATAGTAACGAAGTAGATGACCGCACGAGTAACCGGACTCATGGACCGCATTCCCATACCGACACCGTGGAAC
ACACCGAGAAGAACGACGGTTGCAATCGCAGCACCAAGCGAGTATCCGACGTACATGATGTCAGATGTCTCGAGGGTTGCCACGTAGAACATGAGCAGGA
AGTGTCGGCTTTCACGGAGGATAACAGTGACACGCGAGATCATGTTCGAGTTGTGCAGCTGCTCCAGGTCGCCCTTCCACCAGCCTACCCAGCCACCCTT
GTTCGCCGGATCATCATCCTTGTAGTCTTCCGGAGCAAACATCCACATGCACCACTGCTTGACATCAACCTTGGTTTTCCTGAAGTCGAGACCGTCACTG
TTGAACATGAAGGGGCCGACCACCCACAGAATGGAAATGAACCACACCGAGAACGTCTGCACACCGTAAGCCTGGGCAGTCTCACAGTAGTCGGACGCGA
AAGTGTTGTCGTTGGCAGACGCGTCGGTCTGACAGATGTAGAAGTTACCAAAGGCCAAGTACACAAGACACAAACCGATCAGCTCCCAAGCTTTTCGATA
ATGTGAACTTGCATACGCTTTGTATAATAACACCAGCGTTTCTCGAGAAATCTTGAAACCACGGCCCGTGGCCTGGTACTTGGCACCACCGTGCACGATG
TTGTTGTCGAAGTAGTGCATCGTTGTACCGACTTGGAACACGAAGAAAGCGGGGCCGAGCGTGATGATCATATCGATGAATCGCGTCATACCGCGCACGA
ATCCGCCTTCGCCGAAGTACACGCACATCAGCGGAAGCATCAAGAAGGTACCGGCCTGGATGTAGAACTGCGTGTTCAGCACTGCCTTCAAGTCCTTGAA
CACACGCTCGTCGAAATTGTTCTCAATGTTGTCGGTAATCACAGCAGTCGAGTTCATGTTGTACACAATTTGCTGCTGAACACCAGCAAGAGCCAGGTAC
ACCTTGCAGTACATGTACACGAAGGTCGTCACAATTGTCATCCACGTAGCGAAGTAGAAACCCGTGTGCGAGTAGTACATCGAGTTCAAGCGGAAGAAAT
CCATAAACTGACCCATGCGGTGGGCCTCACGGGCGAGAGAGGTTTCACCGGCACCGTTAGCGAGCTTACCCTCGAACATGGAAATCTGGGAAAGAGCCAC
GTCACGACCCTTACCACACTGCATGAACTCCACGTGCGTCACGACACCACCACGAAGCGTCGAGTTGAATCCGGCGAACACATCTTCAGACAAGTTGATA
CCCTTACTAGCCTTCGACACACCACCACGAGGCATTGCAATAATCTTGTCGAAAATATCAGGGTGACCGTAGTGCATACGGACGTACAGCGGGTCAGCCA
GCACACGCTGAGATAGCGTCACGAACACCAGCTCCTGCCATGACTTGAACTTCGACAGCGACGAAGCGTTACCCGTGAAAATGTGCTCACGCATACCAAT
AATCGACACAGGCTTCTTCGAAGGGTGCAGGTCAGCGGTCACCAAAAGCTGCGGCATCTTCAGACACTCCTCGAAGTAGTGCTGCTGGTTCATATCAATA
GTCTGCAGGTACTCACCACGCGTGAACGGAAGTGCGTTGTTCTGGTTCTCAGGCTTACCTTCACCAAGAATCGGGTCGCCAGGCAGTTCGTAACGGTACA
CCTCCGCGATTTCGTTGCCTTCACTCTTGATCAACACAGTGTCGAACTGCTTGCCACCGTCAGTCACAATCGTGTCGACATAAGCGACACGCAAGTTCGG
GTACGTCTTCAGAAGGTAGTCAATGTCATCGGCCTGGGCCTTACCCTCCTTGCGATGCTTACCGTACACTTGACAAGCGCAAATGTACGAGAATTTGAGA
CGCACCATGTCCTCCAGTTGAGCTTGCTTCTGCTCAGCAGTCTTACCAGGGCTCGAACCGATTTCCAGCCAGTGAAGGATCTTGATAGCGTCTTCGTACA
GCATCATACCCTGCACAGTACGAGCGAGCGTCTGACCACGATAAGAAGCCCAGAGTCGAATTTCAAGCGGATAGTTTGCCTCTGCCTCCTCTGCAGAGCT
CACGTCAATACGCTCCAAAAAGTTCTCCCACTCCTCCGGGTGAATTGTGATCAGGTACTTCAGAATGGTAATGTTCTTGCCCTTCTCTTCGACCTTCTTG
AAAACAGGGTGGTTTACCAGAGGGTCGTTCAGCTCTGCTAGCGAGATGAGCACACTTTCACTGTAGAACGGCGTCACAACAGAGAAGGAGTGCATTTCCT
TCACCGACATCAGCTGCGGGATCTCCATCACAAGCGACTTCATGAAGAAACCAAGACGACGCTGGGCTTCCGGTACGCGCGGCATCGCGTCCGCCTTCTC
GAGCGACATCAGCAAGTAGGCGCGCGTAGCGGCGCCCATAGCAGTGTCGTTGTGGAAGAGGTTCACCAGACCACGGGCAGCAAACACGTAGCCGTTCGCA
CTTGAGCAGAACTTGGAGTTGCTGAACTTGGCGGCGAGCTCCGGTCGGTTCGCGAGGATGCGGATAGCGTTAAGCAGGTTCTCCATCTTGGTCACGAAGT
TGCGGACCACGCCCATGGTGTGCACACGCGACGTCGTCAGGTGCGACGACTGAGCGTCCGGGTCCGGCAGATCCATCACAGCCTCCAAAAACTCCATCGA
CACAGTACGCAGCTGCACCAAGCTCTTAGCGTCAAAGGTACTCATGAAGCTGCCGTTTGCAGCGATCGTCTCCATTTGGCGGAGCGCATCCAGGATATCA
GCATCGTCGCTGCCCAAGAGCGCCTCCATCACGTACATACTAGCCGTGAAGAAGCTACGCACAGCAGAGAGACAGTCCTTCTGCACCATGTACACCTGCA
GTTGCGAATCGCCCTTGCCTTCCTTGGCCAGCTTGACCGTGTAGTCGAGGGCTTCCACAAGCTTACCTGCCGACAGGAACACCGGCTCAAACACATCTCC
AGAGCTCTGGATATCGTACTGCAGAATGGCGGCTTCCTTGTCGTCCACCAGGTCGCCCTCGCGGAAAGAATTCACGATTTCGTTCCACACAACGACGAAA
CGCAGCATCATCTGCGACTGGTAAGCAGCGGCAGACCCATCGGCGGCAGCGTCGTTTGACCGAGCAAGGCTGGTCACAACCTTTTGGTCGAACAGCTGAG
GTGCCACACGGAAGGCCTTGGTGATCTCCTTGATGCCGTGAATTTCACCGGTCTTCATGATGAGACCCTGGATGCCACCAAGGGAAGCTTGGAACACTGT
GAAGTAAATCTGGGTGTCGTAGTTAAAGATGAAAATCACCGGCAACCACAGCGCAGCGATCACACCGAAGTTGTGGAACGACACCACGTTGCTACCGTAC
TCCAGCTCCATCTCGTAAATGGCAAGCGACGGGAGAATCAGCGGGCGCACCAGGATAAAGTACGAAATGTAGGCCTTCAGCGCCCACAGGACGAGCCAGT
AGGTGATGTACTTGATCTGGTAGCTCAGCGGCGGCGCCATGTTACGACCAACGTAGCACGTCTCACCCTCACGAATGAACTTGGCAGCGAACGTCTTGTT
GATCATCGACGGCGCAAAGGCCTGAATGGTCATGATGATCGCGCCAGGCATGATGTAGGCAGCCGACGCCATGGCCGCCTTGTCCAGCAGCTCCGTGTTC
TCGCTCGTGATCAACGGAGTGTAGATCATCAGACCGAAGATACCCGCGAAGACACCGTTCCAGAGCATGCGGACCACCAGAGCACCTCCGTAGTTGAACG
ACCGTGACGACGTCTGCGACGACTCGCTAGCAGTCAGCAAATGCCAGCCGTGGCAGGCCTCCAGCACAGTCTTGCAGAAGCCCATAGACGAAAGCGCGAA
CACGATACCCACGTACGTGAGCTTGACGTCCTGCTGCTGGTAGGGCTCGACGACCTGGCCCATGGAGCCGAACTGGGCGAACCACTCCTGTCCGCCGCTG
GGCGAGATGGCCGAGATGAAGCCGATGGCCATGAGCACCATCATGAACATCATGTTGAACTGGAAGATGCGGTAGTAGTTGAGCACGAGCGTGAAGATAC
TGCGGTGCTCGTAGTACGTCTTGGTGTGCTTCTTGGTGAGCTCGTCTCCGATCTGCGTGATGTCAATGTTGAGGCAGTACTTCTTCCAGAAGTACTCGTT
GATGTCGTCGTAGTTGCGCACCTGCGTGTGCTCGAGGTTCTTGCCGAGGCTGTTCTTGCGCTGCATGTTGCTGGCCTCCTTCCAGATGGGGCGCACGACC
TGGCGCAGGTACCATCCCTCGGGCACCTTTTGCTGGCCGAGGAAGTCCTGGTTGAGCATGCACAGCGCCTGGTGGTACAGGTAGCAGAGGCACTCGGGCA
TGTGGCGCAGGTTGCCGGCCTCGCCCCAGAGCAGCAGGAAGAGCATGATGTCCATGTGCAGCGCGTTCTTGAGGTCGCCCTGCGGCTGGCCCGTGTACGT
GACGCTCTGGGCGCCGATGAACTGGCACCAGTCCGTGTAGTTGCTCATGAGCTTCTTGTGCAGCGTGAGCACGTGGTGTCCCGGCGGGTCCTGCGGCTTG
GAGCGCGCCTTGGCGTTGGCCAGCAGCAGCAGCACGTGCTCGCGCTGGTTGTCCACCGAGCCCGACTGGAAGCCGAACTTGTTGTACAGCACCTCGCAGC
AGAAGTCGATGGACACCTCGTCCGCGAAGTCGCCCTCGAGACCGCCGCCGCGCATGGCGCTGCCGCCCTGCGGGGGCACGACGTCCATCATGCTGAGGCG
GTCGCCGAACGTGCCGCGCCCGTCGCCGTGGTTCAGGTGGCTGCGGTTGGCCGACGTGTTGCGCTTGCGGTCCGCGTCCAGTTGGAAGTAGTTGGAGCCG
GCGCGGCGGCGGTCCGTCTTGCCGCCGGGCGT