Description :
From Genome Similarity Track
Location :
Scaffold_2:167305- 229639
Transcript NameFunction/comments
Phyci_207508Mitochondrial Carrier (MC) Family
Phyci_207572Hypothetical protein
Phyci_60860Hypothetical protein
Phyci_8897650S ribosomal protein L13 putative
Phyci_75834Hypothetical protein
Phyci_206967GF18527 putative
Phyci_207198GTPase, putative
Phyci_469tyrosine aminotransferase
Phyci_298024Hypothetical protein
Phyci_88985Hypothetical protein
Phyci_75840Hypothetical protein
Phyci_75841conserved hypothetical protein
Phyci_564300conserved hypothetical protein
Phyci_564302Hypothetical protein
Phyci_75843conserved hypothetical protein
Phyci_23363hypothetical protein

Sequence
62334 bases(100 bases per row)
CCCTGATGCAAACTCGCTCGAAGTGTTTCCAGCACTTGTTGCCAACAAGTTGTCGGTGGTCCAGCTGGTGCTCTGTTGCCATCTCTGCAGTCGCGCAGCA
GGGGATGGGTCGCTTCAACCAAGCAGAGTCTGAAGTTGTCGTTTGCGGCTTGCCAGCGCTGACAGAAATGCTTGACTCGCCTCGCCGTGCAGGTCTCTCC
AGCAAGTCGACAAGCTTCGCGCATTCTGGGTGAGCTTGCGTGATGGTCCATGATGAGTCCGAGCCGCGGGGCAAGGTGTCGGCCTTGCATAGAGGCGATG
AATCTCGCCTCGCGATTCAATCACTCGGAAGTGATTGAATTTTCGCAGCAGATGCGGCCTTGTGCCTAGCCTGCTGGTCAACAAAGCCAAGCCCATTTCG
CTGCTGCTGTCTGCGCTTTCGACGGTTCAGCAGTTAAACCGGGCGCCGTCACCTCATGGCGCTCCTGTGCGCGGGCAAAGACGCCCGCGTCGAATCCACC
ACGAGCAGCAGATCCGATGCTCCAGCAGGCGGTTGACGGTCTCTGACCACCGCATCCTCCTCGATGATCTCATTCTCGCTTTCGCAGCCCCTCGAAGAGC
TATCAGCACCTTGGTCAACACCTTTCTCCTCGTTGAAGACGATGGCGACCCAGACTGGCGTGAAGGAGGAGGCCCCGCTGCAGATGAAGGCGGTGATCGA
GCCGCAGTGGACGCGTTTCCTTGCGGGTGGCGCGGCGTCGGCGACGGCCGAGCTGCTGACGCTGCCAATCGACATCACGAAGGTGCGGCTGCAGGCGCAG
CGGTCCGGCCCGACTGCGGGTGGCAAGCCCGCGGTGCACTACAACGGCATGCTCCACGCGGCGCAGACTATGATTAAGCAGGAGGGTCCTGCATCGCTCT
GGAACGGAGCCACACCCGCGCTGCTGCGTCAGGTGTCGTACACGAGCATCTGCATGGTGCTCTACGAGCCGCTACGCAACTTTTTCGGTGCCAACGCAGC
GCAGGGCGCGAACGGCGAGGTGCCGTTCATCAACAAGTTCCTGGCCGGCGGCTGCGCCGGCGCCATTGGTATCAGCATCGCAAACCCGTACGTTGTGTCC
TCGGTCTGGCGTTGAATTCGATGGAGGTGTGCTGATCGCAGGGTGTTGTTGTTTGAATCTATAGCGTGGATGTCATCAAGGTGCGCATGCAGGCGGACCG
CTCGGGCAAGTTGTATCGTGGAGTGGGCGACGCGTTCACCATGATCTACCAGCGCGAAGGACTGCGCGGGTTCCTCCGCGGCATGCCGCCGAACATCCAG
CGCGGCTTCATTGTGAACGCCGCCGAGCTGGGCACGTACGACCACAGCAAGGAGCTCTTGATCTCGTCCGGGCTGCTGAAGGAGGGCGTGCTGGCGCACA
CCGGCGCCAGCTGCGTGGCAGGCTTCGCTGGTGCGGCGGCATCCAACCCGTACGTGCTCTTGCTTACTTCAACGTGGTTTGAAGGCGTCGACGTTGACCT
TCTGTTTGTGGTGATGGTTTTCGTTGTAGGATCGACGTGGTCAAGACCCGCTTGATGAGCCAGCCGACGGACGTGAGCGGCAAGGGCCTGCACTACAAGG
GCATGATGGACTGTGTGCGGAAGACGTTCCACGAAGGTGGCTTCGCCGCCTTCTACAAGGGCTTTATCCCGAACTGGATGCGCAAGGCGCCTTGGTGTGT
GGTGTTCTTCGTTTCGTACGAGAAGTACCGCAAGGCGCTCACGCCAAGCGACGAAGAGCTATAGACGCTCGCCTGTGCTAGACTGCCAGCAAGCGCTGCT
GGGTCGGCAGGAACAGCGATGCCCTCCATGGGAAACGTAAAGATATCATTTTTGTTATCACCATTGTGTATATTGAACGTTTGATGCTTGGAATGACAGG
CAGAGGTGCCCACCGACCCACGTTGGCTTGTTTAAATAAGGGTACAAGGCACCAAGCGCGTCTCTTGCGTATGTGGCCATGGGATGGCGTGGCGTTTAGG
AAGCTTCTCCTTCACTTCTTTCTGTTTGGGGTCGCATAGAGTGCGACGCCGTGAATAGTTTTTCTTCGACCACCGCTACACTCTGTGGGTGGCTCGCGTA
CATGCCCACCTGAGCTTCACTTCGTTTCTTCTCTTCACTGTATTTCTCATTCACGGATCACCAACGTATCCATTCAGCACTTGAGCTCCTCGAAGTCGTG
CATCTGCATGTACCACGTCGAACGCGGCGGCGTGAGGTAGTGCAATGTCGAAGCCCCCGCCGGCATGCTCTTGACCAGCTTCTCGCGCAGATCAATGTAC
TCGTCCGTCTGCACGACTTTGATCTTCTCGTTGTCCGTAGGGATGGACACCTTGCCGCTATTGGGCAGCATCACGATGGGGAGCCGCTCGATCACGCGGT
CCTCCGTGGACCAGCGGTCGCGCGAGATCACGTGAACGTTGAGGCTGGAAAAAGAGCCGTTCATGAACCTGTTCGAGATGGTGCTCTCCACCGACTGCAC
GGGGGCCTCCTCCTCCTCTTCCTCTTCCGAGCAGTAGTAGGCTGGGCACGTACGTCGACGGCGCGCGGCGGTGTTGGTGCTCTTGGAGAAGAGCGAACGG
CGGAAGCGGTCGCGCTCCTGTCGGCGGCTCTCCAGCATCTCCTCGCGGTCCTCGCGGGACATGCGCTGCTGGCTGGAGCTGTCGTTCATAGGCGCCACCT
GGTTGTTGCTGCCCCCGCCCAGGAAGCTGCCGTTGCTGCCGACACTGCTGCGGTTGGTGCGATTGAGCGCCTTGAGCAGCTTCTGCAGCGCCAGGAACGT
CTCGTCCACCTCCTCGTCCTCAGCGGAGAAGCCAGGGTCGTCGTCCTCGGATAGGCGGCCGCCGTACGACGGCAACTTCTTGGACAGTCGGGCATCTCGC
TTCTCGACCGTCGCCATGGCTGTGGGCTGTGTGCTCAGCTGTGGGAGAGTCTGCGGTGACTGATGCTGCGGCCTCCGGGTCATGCAGCAAAAGGTGATGT
GGGGATGGCTGTTGTGGCTGCGGGCTTCCTCCGTGCGTGCGGCGCTCGCTCGCTCGCGTGTCTACAGGTGAGAGGGTGTGCTCGCTGGCTTATGGAGCGC
GCTTCTCGCAGCCGCGCTCGGACTCCTGCTGCCTTCTCCGCTCTGCTGGTGGACAGCAAAAGTGATTCTGGGGCGCAATCGGCGCCTGCGCTCGTTCGTT
CCACGGTTCATAGACACGCTGGTAAATAACCATCGGTTTTCGCAGGGGAATGTAAGAATGTGGCTATGTTTCGCATTTTATTTTTCGGCGGAGAAGCGCT
CAGTCTATCTTGGAGCGGGCTGGGACGGCGGCCAGCAGGCTATTTCTTGCATGTGGCTTCCGCGGTTGGTGGCGGCGCTGGCGATCACCGCTGGCGTTCG
CCGCGCGTGCTACCTGTACAGTAGTAGCTGGCAACGACCAGCGTGCGGCGTCATCCGGCGAGAAAGTGAAGGTAATTTTGCCGGTGGGAGTAGGGTTGAA
ACTTGGGAAGGCCAGCGTGGCACTGGCTGGCTCTGGAGTAACCAGCCCTAAACTGCCCACGCCGGAGCCCTCGGGCGGATTTGCTGTAAAGCGGCGCGTT
GGTAACAGGCCGCGTCCACGCAGACCGACATGCTCGCGTTGCGCTGCGTGGCGGCCGCGGCCTCGCCCGCCACGCAGGATGATATGCCTGGTTGCCGCGG
GGTCGCAGGGCCGCCTATCGCTGCTAGTGCACCCACCGGCGGGTGAGTGCTGAGCACTGGGCTCCGGATCAGTTCGGAGACCACTTCTGCAAAATGAGCC
GCTGGCTGCCCCTGCGGTAGATATCGTTTTTGGCCTCGCAGCCGCCTTGGACTCAGTTCGCACGTGGTGGCGCCATCGAGCCCTGTCGCAAAGTCCTAGT
GCAACTCGCAATGAGACTTCGGAGCAAGCAAGACTGCCTACGAGTCCAACACACCCAGAATCTCCTCCGGCTGCGACGAGACTCCTCGGAGGCTCCGACG
GAGCTGCTGGCAGCTTTGCTCGTACTTAGCCGAACGCTGTCGGTTTTCTGTCCGCCGCACATCCAACAGCAGCTTCAACTTCTACGTAATCACCTCACCT
GATGTGTGCCACACCACCGGCTTCAACTTGGCGACCCTTGGCTGGATCCGTTCGCCGCGCGCCGCATTGCAGCTGCTGGCCCTGCTGCTGCCGCGATGGC
GGACCTGCTGCTGCGCTGGCTCAACCATGAGCTGGAGCTGTCCACGCACGTGACTGACGTGGAGGCGGACTTCGCCAGCGGCTACCTGCTGGGCGAGATC
CTGCACCGCCTCAACCACCAGCACGACTTCGCCGACTTCACGCGCAGCTCCAGCGCCGACGCCAAGATCCTCAACTTCTGCCTGCTCGAGCCCACGCTGC
GCAACCTCAACATCAAGTTCGACGCCAACGCAGCCGCCGCCATCATGAACGAGAAGAAGGACGCCGCCGCCAACCTGCTCTACCAGATCAAGGTGATGGA
TGGAGCCAAGGGGTCTCTCGCGCTGGCCACAGGGACTCCTTATCTCGTCTAACCCGTTGCCTGCGTTGCACAGATCGCTGCCACACGCGTGGGGAGAGCC
CCGGGCGTCTCGTCTAAGTCTCTGGAGCGCACGGGCATCTTCCCGCTGCACAACAGGCCGGTGAAGCTCGCGAAGCCGAGCTACGATTCGGAGAACCACC
GGCTGTTCGAGCACTCGGTTCGGCGACATGTTCGGTCCATTGCATCTCTGCAGCAGGAAAAGTAAGTGTGAAGTGAAATACGTGCTCAACTGCGATGTAG
GTTAATGTAGGTTGGGGAATGCTGACGATGAAACCTATCGCTGTTTGTCTCTGCAGAGACCGGATCGCGGAGGAGGCCACGAAACGAAAAGCACATCTGG
CGAGATTGGAGGACCAGAAAGAGCTTTTGGAGGCCACAAAGGCAGAGAGGTTGCACCGCGCATACATCCACAGCAGCTTTATTAAGGAAGCTCTCGAAGA
GACAGACTCGCCGGCCTGGAGACAAGCGCTGCAAACGAAGAATGCGCGGGAGCAACGTCGGGCTGCATTCTTCCAACAGCTGATGAAGAAACGCGAGGAA
GCCGAGGTTATATGGTGCTTTTGAATGTGTTATCCTCCCGCTATCGTTGTGGTGCTAACACCTTGGTTTGTTTGTTCCAGGAAAATCTCACCTTTAGCCT
TCGCCGAAAGGTGCAAAATGATCTGGACGACTTTTACGTACGTGATCAAGATGCTCGCTTTGCTTTTTTCGTTTATGGAGCTACATGTTAACAACATGTT
GCCTCCTTGTAGAGCAATAGTGATTCAGAGAGCACGCGTACCGGTGGCAAAGTTTCTTCACGCAAATCAGTTGGCTACGGTCTTCGCTCGCTCACGACTG
CTCTGGGAGCAACTTCCGATAAAAAGAAGTATTCAACCTCGAATTTGGCAGGATCGTCCATGAACGAGAGGGAGCTCTACCACGCCAATATGCTGGAAAT
GGAAAGTGCCAGCGGTGTCATTAAACAGCAAAGGCAACAGCGAGAGAAACGCAAAGGGAATTTATCTCGCAGGCGAAAGCGATTTGTTCAAGAATGTGTT
TATTCCCACTCTCGTATAGGAACTGCGCGAGTGACAAGTATTCTGGAGGATGTGGTGCTGCGAGACACGAACAGTGAAAAAGACGTACACGGTGAAATGG
GCCGCATTCTTACTTACAAAGAGGTGGCTCGCGAAAACAGGCTAATGCGAAATCAAGAATATCTCAACCAACAAGAACTGGACTCCATGTCAGAGATTGA
CCGAGATACTTGTTGCTATCATAATTTGCTTCTCAGATTTGAGGACGACAGTGAGATGCAGGTGCTACAACGCAGCAATGTGCGTGTGTCCATTGAAGCA
GCAGCCCGCTACCTCAGTGAGCAGATTTCAGCTGAGATCGTGGATGACATGGTGAAGTTCGTGCTTTTCATTGCTGGAAAGCGAGAAGAAACTTTGCATT
CCAGAGACCCTGTCGTATTTCTGACTGCGGAAACCTGGAATGAGTACAAAGTCAAGTTTGCTAATGGCCATATATCTGGGAAGGAGTTTCCACGGGCAAC
TCCAGATAATTCTAGCCACGTCGAGTTGTTAGATAGTCACGAGCTGGAGAATTATTTATCAAGATTTCAGGTATTTCGTACTAGAACTGACCAACAATCC
CCCTTGTTGGCGATTGACGATGGGTCTCTATTTCTCGGAGCAACAAGTTTCATAGAGGACTGTTTCGTTCTGGGAGAAACAATTAAGTCGCTACGTTGGA
TTTCTCGCTTAGCGGATACGGCCTCAGAGAGAGATGATGCGGATAACGACGACCCGCACTTATCTGTATCTACTCGCCGAGCGACAAAATCCCTCCACCC
ACTCCGAATTCTTATCTTTGGCCCTCCGTTTGCTGGCAAGTGTACGCAAGCCAAGCTTCTGGGTGAAACGCATAATTTGGCCGTGCTCTCAGTTCACGAT
CTTATTCAAAATAGCGTTCAAAACTTAAGTGTTCTTGGCCAGGAACTGGAGAAGTTTCTAACGGAGGGAAAAGAGGTTTCCCCAGAGCTATACAGTCGTC
TCGTAGTTGAATCTATTGACGAGATCGAGGCGGACTCACTTGCATCAGAAGGTGGCAACAAGACTGGGTGGTTAATTTACGATCTCCCTGCAACAGAACA
GCATAATCGGCATTTGGAAGAGCAACTAACCGGATATGTGAACCCTGCGGTTATTCCCTGTCCGTCTGACTTTGCGTCTGCGATTGCTCCGGGTCTCAGC
AAACCAACGCTGTCTCCGGCATTTCTCCACGGTAAATCTGGTGTAGATCTCGTTTTCCATATCGATTGTGCTGCAGATACAGTCCTCGACCGATGTTTAG
GTAAAGTCGAAGACTGCGCAACAGGCGATAAACATCACTTGGTGTTTGATCCGCCACTAGACGATTCCGCTGCACGACGTCGTTTACAGCATATAAATCC
AAGCGCGTTCTCGAGCGAGCTGCTTGCTTTGCATTGTTTGGCCAATGAAGAGTTTTCACGTGATCATAAGGCTTGGTACACCAAATTCAAGACATTGCAT
GAGCCATCCAGGCCCGGGATGACTATAAACGAGTGCCACGAAGCTATTGCGGCAATTGTGAATCAGTTTCAGAAAGAGAGACAAGACGAAGCAGAGTCGA
AGCAGCTACAGGTAGAGGCAAAGGAGCAAGAACTTATGGCAAGCGAGGAGGAGAGACAAAATCGCATATGCTCATTCGAGGCAGACGTTGATGAGGCTAA
CGTAGCCATTGCCAAGATGGAGGCGGCTGTGGCGGAGGCGGAGGAAGCAAAAGCTAAGAAAGAGGAAATTTTGGAGCTACGCCAAAAACTAGATGAGGCT
CAGCGTCAGCTAGATAGTGTCGTGGCTGGTGTTAAAATATGGATGGAAGAAGAGCAGTCACAACGTCCTATACCAAGCAGCGAGTTCTCTGGAGAACTTG
TCCCAGCAACAGCACAAGCACTGATAGCGTTGTGGAATGACGCAGAGACAGAATATATTTCTATCCTGAAGTCAAGTTTTGCACTGCTGCGGGAGCAACG
ACATCGCGTCACTGAGCGCGCGCAGTTAATGACAAGTGAGTTTTGTGAGTTCTTACGCCGTCCCGATGAAAAGCAAGAAATTGTGAATCTGTTTCAAAGG
CAGTTCAACGAGGTGGTGGAAGAAATGCGTTTCGACGATCTCACGAAGTTAGAACTCCATGCTCGTGTTGATGTGCTGCAGGATGAACTTGGGGCTCTCA
TCGACGCCAAAGGTGCAGCAAATGACGATGAACTTAGTAGTATGGTTGGTGACGGATGGACTGAGGGAACTTGTCAGCAAATTGCAGTCATCTATCAAAT
GGCGCTTCAGGCGGAATGCGACCGCTTCCGCGTCTCCGTCCAGCTTCTTGTAGACGGCCACTACGCTGCAAGTAGTGAGCGTTCTCAGCTAAATAACATT
GTGGAGACTTGGCACGGACATCAGTCTCGCTTAGAGATGGCATGCCGAATTTATCGAGATCCGGCAAACGATACACCGGTAGACGCTCCGGTAGCGCCGC
CAACAACAGCAACAGGAGGGGGAGGGAAACCTCCGCCGAAAGGTAAACCAAAGGCGCCTGCACCTGCTGCCGTGATCCCGAGTAGTGCAGTCGCAATAAG
TGAAGACGCCCGAGCGGAGGTACTAACTATAACCGAGCTGCTAGCAGAGTACGCCGACGTTCTTCAGCGATGTGGGTCATGGATGGAAGCAATTGCTTCA
ATTGCGACTGCGGAAGGAGGTGACGCTGGAAGCCAGGAGCACAATGGTGACTACTGCAAGATAAATTTGCTGAATGGTATCAGATATGAACACGACTTGA
TGCAGCGACGAGTGAGATTCCTTCAAGAAGCCACGGAGAAGGCCTGCGATGAAGTCACGCGGTCAATGCGCTCGGTCGAGATCACATTGCGAGATGTCCT
CGAAGAGCGTAAAGATCGAGAGCAGGTGGCTGTTGCAGACTTGGTCGCGTTCATCCGCACCGCTATTGAGGCCGAAATCGCTATTCCGTTGTTCGTAGAT
GTCAGCGTGAGTGTCGAGCACTCTCTCTCTCTCTTGTTGATGTTTTCATGCGCTCTGATCTGTGTTTGGTCGTGTGCTGTAGCCGGACTTCATCGAGCGA
TTTCCAACAACTGTACAGTTGCGGGAGGACACGACTGTGCGTGTCAATGGAGATAGGCGCTTGCTGCCTCGAATTCCTCCAGACGCGCCGCCCATTGTTG
AAGAAACGCACGAAGTGGTGCTCAATCCTCGCCAACGCGACAGCCTCCGGGAGGCATTAGCATCGCAGACCTGCGATAACTCAGGGCTGATTCCCTTGTG
CACATTGGTGGAGATCATTGCCGCGTTGACGTCTCAACCTGACGCACTTCCAGAAGTCTGGCGTCGATGCCCCGCACATGCAATTGCTGAGGTACGAGCC
TCTACCCACTTATCCATGCCTCAAATACGACACTAACCTGCATTCTCTCGTCGCACCGACAGATCGCGGCAGGCTTCACAATGAAGCAGTCGGCGTTCGT
CGACATCGAAGCTCTGCTCACTGCAATGAGCACCCGCGAGGACCTGCTGCGCCAATTCCAGGAAGACGAGGCCCGAGAAGAGCTCGAGCGACAGCAGCAA
TTCGAACTACAACGTCAGCGAGAAGAGCAGGAACGCGAGGTCCTCCTGCAGCAGCAACAAGAGGCCCCAGACAAAGAACCTGCACCCACCGACGCGGTAG
AATAGCCAGCAACTACAACAACAAGAGCGCCAGAAACAACAGCATCCAAAACGAAGAGGCCGTTGCAGGTAAGCAACAACCGTGTATTACCCTCCATCCA
CTCACTCGCGTCCGCTGCATTTGCCTGGCCTCGTCGCTCTGCTGCCCACCTACTATCCAtctctctctctctctctctctctctctTGCTCTATATCGCC
TCCAGCCTACAGGATGACAGGGTTCTCGCCCACCTCCGCGACGAAGTCGTGCTCCTCGCCCATGAAGATCTTGAGCTTCTTGTCCTGCAGCGCGCGCATG
CGGTTGCGGGGCAGCATGCCGAACACGGCCTTGCGCAGCACCTCCTCGGGCTTGCGCTCGAACAGCTCCTTGGCCGTGCGCTGCTTGAGGCCGCCCGGGT
GGCCCGTGTGCCAGCGATATAACTTATTGTTCCACTTGTTGCCCGTGAGCACGATGTCCTTGGCGTTGATGACCACCACGTAGTCGCCGCAGTCCACGTT
CGGGGCGTACGTGGGTTTGTGCTTGCCGCGCAGAATGGGCGCCAGCTGCGACGCCAGGCGCCCGAGCACCTGTCCCTTGGCGTCCACCACGTGCCACGCC
ACCTTGGAGGCCTGCGCGATCTTGCTCATGCTTGCCTAGCGCTTCCGTCCGACGTCGAGCTCTGCTGGCTGCTGGCCCCAGATCACGATTGAGGCCACCC
GTCGCCGCGATTTATTGAGGGCGTACTTTACCGGGTTCGGTTGTGTAATCTAACGTTTGATGTACTTGTACACCAATCAAGCGTTCGTTTAAAAGCAGCC
GATGAAAAAAAGGGTACATACAGCCCATGCTCATTTCCAAAATGGGTCGATACACGACGGTGCAGACCTTCAGCGACCAGGACGCGCAGGGCGCCGCCGT
GGCGGAGCCTGCGCCAGCCGCCGCTGCCAATGAGCCCAAGGACGCGGCCAAGTTCCACGTCAACCGCGTGGACAACGTGTCCGGCAGCTCCGCGGGCGCC
GGCAGCGGCGACTTCCACACGTACCGCGCCGCCAGGAGAAGGTAGCGCAGCGCTGCATAGCGTAGATCTTTGTTTTATTCACTGCGGACTGATGGAACCC
AATCTTCTGGCAGAGAGATGGAGCGCGTGGCGGCCATGGAGCAGCGCTACAAGCAGAACAAGGCCCAGCAGGAATTCGAGGCCAAGCGCAAGCGCAACGC
CGAGGAGTTCGACGCCAAGATGCAGAAGCGCGCGGACAAGCGGCGGCGGCGCAAGGAGCGCGCGAAGGCCAAGGCCCTGGACGGGGCTCGGGAGGACGGC
GGCGAGGAGCAGGAACAGGAGGAGAAGGAGACTAGTGGAGACAAGCACgagcaggagaaggagaaggagcaggagcaggTGCCCGAGACGCCCGGCGGCG
TGCCGGAGATCCCAAATGACGGCAGCTTTTTGGAGAAAATGCTGGCCTTGCAGAAGCAGATGGACGAGGAGAAGTGAGAAACAAGGAGGGCGCCGGATTG
GTAGAAGTATCCATCCATTCAATCGTTTTTGCACATGCAGGTTGGGTTCTCTTCTTGCTGCTAGCAGGTGTTGGCACGAACATACACACAAGAACAAGAA
CAGTCGACGGCCTAGTTGTCGTCCTGGAAAATGAGCGCGACGCCACGCAGGACCCACTTAGCGCTGCCGCAGTCGGTGGGCAGAGTCGCCAAGAAAATGT
ACGTGTGGCCACGGAAGCGCGTGAGGTACACCGGGCACTCGTACACGTTCGGGTCGTGCCGCAGGTAGCCCACGGAAGACGGCTCCCATGTCGGGGACGT
GGTCACGGCCTTGACGTAGACAACGGGCATGCTCCAGAGCAACTCCTTGGGGTTACTATCCAGCAGCGTACCACCGCACTCCGTAGGTGGAGACGCTCCG
ACCGGGTAGCGTTCGTTGATCTCGTCGAGCGTGCTCCATCGAGCGCCCTCAAGGATGAGCCCGTGCACGAACACGCCGTCATCTGGGTAATACGAGACAG
TCGAAGGGTCCTGGATCGTGGTCACGTGAGTCTCCACGGTCATCTGGTTTAGCGGCATGAACCGCTTACGAGATGTAACTTGCAGACAAGCTGTCGTGTA
GGCGGTGGGGTTGAACAGACCTGGCAACCAGATCGAAAACGGCGTGACGAAGCAGCTACCGCCTCCACCCGTAGTGTCGCCCGCCCACATGACAAGCTGT
TCGTGGCGCTTCACCATGTCAGCGAACCAACCACTAAGAGATTTCGTCGACGGCCAAGCCTTCTTCTCCCACTTACACTGCGAGAACGGATTGCGTCCGG
GCACTTCGTTCAGCGACATAGCTGTAGCTAAATCCTCCATGGCTTGGGACATATTGAGCTGTCCATTGAGACCCTTCTTCAGATCGCCAAGCGATAAGCG
GATCTCCTGCAACAATACATTCATGCGGCTGCATTCCTGCAGCGCCACCACCACGAACGGACCATGCTCCTCAGTCAAGTGAGGTGTTGCAGCTTCCACA
ACGTCCAGCATGTTGAAGAACTCCGGGCATCGAGCCTCCAAGTCGTCGATGGATGCACGCAACACTGCCGTTTTATCACCACCCCCTCCTTCCTCTccac
cgccaccaccaccggcaccaccaccGATGGTCACAATCGTGTAGCACAAAGTCTCACACGTCGTGGTAAGATAGCCGATTTCAGCGTTCGGGTGAAGGCC
GAAGAGCGGCGGGGCTTCGGGGACCATGTTCTTCTCGATGTAGTTGGCGTAGTCTGCAAACGAAAACTCCTGCGGGTTTGGAGACTTGAAGCCTGGCCCG
AGCTCCATTCCGCTAAGTAGACCAGGGTCGATAAGGACTGCCAAATATGTGTTGTTGGTACGACGATCCCAAGCATCCGTGATGTGGCCACCGTACATGA
TCTCGCCAAAGAGATAGCGAAGGTCATCCCACGGAACTGACGCATTGTTGTCCAGATACGAGTGCAGAATGTTGGCACAAATGGTAAGGTCACCAGTGTT
GAAGCTATAGGCACGACTCCAACCCTGCTGCCCAAAGCGTCGGCGTCCTAGCACGATTGCGTGGAACCAACACAGAGAGAACAGGCAAGCCTTGAATTCA
GCCGGCTTAGTGCATGCCTGAACCTTGTCCTCGCCGAAGTTGGCCCAGGCACGCCGCAGATTCGACTGGATATCGGAAGGAGCCTCGTTGGCCACCTTGA
TGCAGCTTTGAAGGAGTGATTCAGGGATGTTCAACATGTCAGGTAGCGGAGGCGGCTCAGCGGAGATAAAGCAGCGGAAGAGATCATGTGCTCCTTCAGT
TGCTACCTCCTCCAGTTGACGTTCAAGTGTAGGCAACCATGATTGCATCAAATGCACGTTTTGCAGGATAATCCAGCCGCCTTCGGTGCTCAATCGCTTC
AACGCCTCACCAGCGTACGCTTCTTGACCTTGACCCATAGAGATATTGATAAAGTTGTTGTTCTCGAGACTCACACCGTTTGCCTTTCCAAGTGTCTCTA
CCCAGGGTGTTGGGTCAACTCCAGGGAACAGCACGAAGAAAATCGGAATGCTCGAGTTCGTCTCGGCGTATGTGGCCTCCATATTGAACGGTGGTTGAGT
GACGTACTCCTCACCCAATGAGTCGAGGATAAACGTGCGCAGTGCATTGGTTACGCGATCGGGGCGCATAGCGCGCAGCAGAATTAGTCGCTGGAATGGC
GTAAGCTTTATGAAATCACCAGGGATCTTTTGCCGTTCTGCATCCTCGGCAGCGAACCACTTTCTCCACTCGTCAGGGTCGTTTTGAATAGCATCACCCA
GTCCTTGGAACGCTTTAGCACTCTCGAGTGCTTTCAACTTCGACCAAATTGCTGCTGGGAGCCACTCTGAGGCTGACCCGGCATTTCCTGCATCTGGGTG
AGCCTTGCTGATGAGGAAGTACTCAACCTCAGAGTCATTCAACAAGCCATCCTTCAGCAAAATCTTCAAACACAGCATCGTTGCCACTGTAAGCTTGTTG
CGCTCGAAAAGTCCACGACGAACGTAGTTATAGACACACGAGGTGATGCTATCCATAAGCACCTGGCATCGTTCCTTCATTTCTTCATCGGTCAGATCTG
CGACGGCAGGTTCACTCTCCACGGCATCTTCATCACTGCCTCCTTCACCACCTTCGCCTTCTGTCGGTGCTGGAACCCCACCTTCAGTAGGAGCGGCCTC
CCCTTCTCCACCTGCACCATCGGGTTCATTGGCGATGAGATTTTTAGCCGGCGGTGCGCGGTAGATACCAGACAAGAAGACTTGCTGGAAGGATGCAAGT
GAGTAGATGTAGTATGAGTGCACCTTGCTGATATCGTTCATCAAAAAGAACAGCAGCGAGCCTCTCGCAGCAATACTGCGATACTTTTCACTCGTAATGT
TCACAGACTCCTGCGTTTTCTTGGCAGCTTCCATGTTGTTTTGCGTGCGCTGTGCCTTGTGCTTCGTATCACTTAGAATCTGAATAAGAGGTTGGTTGTT
CGTGATGTCATCATCTGCACTAGCCAAGTAGAACAGAATATCATCCTCCAGCTTTTTCAGCTCGATCTTGCCGTTGTTTTGTTCTTGAATCAGTTTTTCA
CGCTTGATGGCCAAATCCTGTCGCTCTTTCGACACGACAAGGTTTAGCAATTGGTCTTCCAGACCAAGCATCGTGACAGTGAAATTCACGATGGTACATT
CTGCTTGAATCTCAGGCGGGTAGTGAGGGTTACCTAACTTCGTGTGCAAATACAAGTGAAAGTTGTCGTTATACGGAACGGAAGCATCACCAATCTGGAT
TTCGTATCGCGCACCGCGACGCGAAGTTGAGCGCTGAATAACAGGTGCCAGGATGGGATCAATTTTCTCGCCTAAGTTTTCGATGAGGAAGGCTCCATCA
GTACCAATTGCCGTTTTCAAGCGCTCAATCCACATCTTCTGCCCCACTCGTACGATGATAAGATTGTTGTGCGCCTCCATCTCACGGATCCACGCAATAG
CTTGCAGCTGTGGGTCGACAATAAGCGGTCTTCGACCCATGGACACCGTGGTGACCACAATGGCACCGTTCTCTGTTGATACGCGATCTGACGGGAGTTT
TTGGGTATTCCACTCTGCGATCTGGGCGTCGTTTGTCAGAATGAGCAGAGGGTTGGCTTCCTCGGACATGGCAATGCTTTCTCCACCCGCAGCAGTCCGC
AGGTATGGCACCCAGTGCTTGTTAATGAGTTCATCACGGAACGGTTTCGTGAACGGGCCAATATACGAAATGAAGGCAGAGGCGAGCAACACATCTCCCA
CCAGCAGATCCTTCTCCTTCTGAAGCTGCAAAACATTGATACCCCAACGCACATTTTCGCTGGACAGATCATTTGTCAGCGTACCTGCCAGCTTCATCTT
GCGGTTGCCGGTTTCGACTGCATTGATAGCGTCTTCCTTCTCTTTTTCCGCAGCTGCGGCCTCAGCCAGAAGTTTGTCCAGTTTTGCCTGTAGATCAGCC
ACCAGTGCTGTCACTTCGCTTAGACGTGCGTTTGCAGCTTCAAGTTCCAAGTTAGCCGCAGCCAAAGCCTGTCGCTTGGGCTCAACGGTGATAACGATAT
CGTAGTACATAACGATATTGATGACCCAGGAGCACAAACCCGCAGCGGCCTTATTTTTCGTAAGGATGGTGTCGTAGTTGAAGTGTTCCATCTCCAAGTA
GACGCGGACCTCTTTCCAGTTGTTAGGAGGTACCTTGCCATCGTCTACCACTTGTTTAAATCCCACCAAGTAATCGATGTACTCTGGGATGTTACCCAGA
AGCTGCTTTTTGACTGTATCCCATTTGACATCCTTCACCTTGCCAGTCTTGGTGACTTGCACGTTAGGATGCACTCCTGCTAACAGCACCATCGTGGCTG
AGAAGACATCGTCTACACCAGCGGGTGGCTTGGACATGGTCTTACACTCGCCCAGATCCTTTTTGTTCAGCGAATCAAGTGCAGCCATAGCCTGCTCGAC
AGCAGGCTCGGCCTTTGCGAGATCCTCTTGTGTTGAGCGCTGCTTCTCTGTGACTTCTGCCTGGATGATAGCGCACTTCGCAGCCTCATCACCAGCCTTC
TTACTTTCAGTTTCAACATTCGCCTTCTCCTTGTTGACGGCCTCGGCAATACCAGATGCAACAGCCTTCTTGTCTTCAGCAGCTTCAAGAATGACTTTGA
GCTCTACCTCAAGCCGTGACACGGTATCACCAGTCTCCTTGAGCTTTTGCAAGCCTTTCTCTAATCGATCAATGGCTGCTGCGTACTCCTCCACTTTCTT
GCGCAGAATCTTCTTGTACAGCTGAAGTAATTCCAGATAGGACTTCGGTGTCGTGTACACGTGGCGTCGCTCAACCTGGAAGAATCGCTCTGCGCAAATA
TTCACTGACTGGAAGGAGAAGGGCATGAACTTCTCGATACCTGCCCGAGATTCGTCCGATCCTAGCAAGTCTCCAATCTCCTTAAGCTTCTCACGACCGA
CAGAGAGCAAAGCTTCCTTTGGCCAAGGTTGGAACCAATCGATAACTGTGCAATTTACAAGTGCAGGGAACTTGCGAGCTCGGTTACGAAAATCGTCACC
CACAGGCGAAAAGCACAGGCACAGGTGAAGCCGTTTCCGAATTTCTGCTTGGAAGAATTTGATCACTTCCTTCCGATCCTTCGTACCAGCAACAGGCGAC
AGCAAGTTGACGATGTTGTCCATATCCTCCATTGCGAATAGATCTGGAATCTCGCCCGAAGCCAACAAATCGTTCAAGTAGATCAGGAACTTTTCGTGAG
TAATTTGGGAATCCGTGAGCATGAACACAACTCCTCCGTCTTCTTCGTTGCGAGACAACATCTCCACAACAGCCATGTGCATTTTGCGCAGGTCTTCCTT
AAATTCGTTCTCGCCGTACTTGGAACTGATCGTGATCTGGCGAACAGTGTAGCCACAAATGTGAGAGGCTAGACGCGCCAGCGAACGCTTACCACTACCT
CCCACACCAACTAGCAGTGCATGTCCACTCTCGTTACGCAAAATACGAACAATCCGAGCCACGTGCTTCACTGCATCATCGAAAAGATCCAACTGCATAG
CAGTGTTGTTCTCGTTGTTGTTGTAATCACGCAGCTGGACTTGCAAATTCATCTTGAGGTCGTCCAGGTTGGTTCCCATGATCTGGTCGTATTCACTGTC
ACCATCTTTTGTGAAGTGACAGAAGATGAGAGGCCATGAGTTCTCAGCAGCGTAATATCGACTTGTATTGCAGGACGCGAATGACTTCTTCACTTGCATC
TGCACCAACTGGTTGTACTTCTCAATGTCTGCCTTGCACACAAGTCGATCGCCGTACACGCGTTCGCTCTCGTGTAACCACAGCAGAACGAACTTCTCTG
TGCTATTAAACCGATCCTTTTTCGACGCAATCAAACCTTGGAACACGTTGGACAAATGACGCACATTGAACTCGTAGTGGAAATTAGCTGCTGTTTTACG
AAACGTACTCACAACGCTGGCGTGCAAGCTCAGTGCTGCCTTGATAAGCGCGTTGGAGAACTGCGAGTTGGATAGTTCATCAGCGAAGCCCGACAAATGC
CCACCCAGGAAAGTCTCATAGATCGTGACCAAACTTGGGGCTTCAGGCATTCCCATAGCAAATGTACAGAAGTGACGCTGAAGGCGTGGATCGACGAGGA
AAGAACCTGCTGTGGGATTCATACCAGACACGACTTGCGTATTCAGGATATTCTGAGGTTGAAGCTTCACGCGGTCAAACCAATGACGGTACTCCATCAC
CTGTCGTAACAGCGAAATGGCGCTCTGGGTGTTGTATGGATCCACTTCTGGCAAATTCAGATCATCCATGAAATAGATGAGTCGTGCTTTACCGGGAGGA
CCAAGATTAATACCCGTCTTACGCTCCAGTTGACCAAACATGGTCTGCTGCAAAATCGCACTTGTGGTGTAGAAGTTGAAATTGATCGTGCAGTAGCGGA
ATGCAGCCGTAGACTCGTCCTTGCTGAGCTTTTTCAGCATACCCATAATATTCTGGGTCTTACCCGTACCTGCAGGTCCACACACCATCACCGGAACACT
CTTCGAGATGAGGTTCTCTAGCCAGAACGCAATAGATGCCGTCTCAGTAGTAGGCACAGTAATTTGGTTAATTGGACTCGGAGACACGTATGTCTCGGTG
TAGAAGTACGGGCTCTTAGACCATGAATTAAACTTGGACGTCTCGGGGTCAAGCCAGAAGTCGAACACGGTGTTGCTCGCCGAAGCCACTAACTTAACAT
CCTTCCACTGGTTCTTCCACCAGTTGCTAAACTCAGCCGAGTAGTCTGTGCCATCATCGCTCATAGTGAGAATGGATCCAAAGGACCATACACAACAGAA
AACAAATGTATTCTGCATCACAGTGTAGTCTTCCAGCACTTGAGGGGTCAACAAACAATCGATCATGTTGAGCAAGTTTGTCACAAGCGTCGTCTCCTCC
ACTGGCACAACAGGAACGAGCTTCTTGCGGAAGAATCTGAGCGTTGTCTCGATATACTGGTCAAACAGGCCCTGAAATTTGGCTCGCGTGTCTGGGGTAA
ACATCATGTTCCTCAAACGGTGGTCAACTGGTTGTTGGCAGTGCCGATCCAGCCAACTATCAATCAAACACCGCCACTGGTAGCCTTCCGACGTCGAAAT
GTACAGGATACCAGCTCGCGACACCGTAGCCGGTGTAGCGTAGACAAGATCTCGAATCTCGAAGATCATACGCATATGAACCTTCAGCGGAATACGCTCG
TTCGAAGCCAGGGTAAGCATTCTGTTATCGTCCATGACTGAGTTCATTGACTCGATCCAGTTAGCATCGAGATCGCCATCTAAGATGATCCATTTGGGGT
TGTTATCTTCGTCACCATTGTCGCGGCGCCGTGAACCCAGATCACGCATGATGCGAGACAGCAAACCGTCCTTCCATTCACGTGTCTTCAACACAATGTA
GCCGTACAGCTCGTTGGTGCTAACAGATTTTGGGTTCAAGTCTTGCACCTCCATTGGAGTTCCCATGATTTCTCGCGCCTTCTTTAGCGTTTTCCAAGTC
TCTGTTTTCCCCGAGGCAGGCGGTCCCATTACGAAGACACAGTGACGAATAGCCAACAGTTCTGATAATTGCACAACCTTGAGCATGAACTCCGGACGAG
GTGTGTTGCCAATGGCTTCTGAAGCTCCCTGTACCATCGATTCGAGTTCCATGTCACGCTTGCGTGGAGGATCATTTCGTACATCTACATTCGGACTGTC
GCGCGGGAACAAATCTCCGAGAAGACCGAAGAAAACCACCATATCTTCAGCAACGATTTTCGGGATATTGAAATCGCGCAATGCACGCATGAGCAAGTCA
GTTTCGGGAATATCAGGTTCCGCACGCTTGAAGGCTCCAGCAACGCACAACACACTTTTTACAGCACGAAGGCCCCAGTCATAGTGAAGTTGTTTCGACA
AAAGTTGTCCTAGCAATGAATACAATCCGTAGAACTTAGATGCCAGAATCTTGGCCTGAGTAAATCCTTCTGCCATCAGCATATTCTCACAAATCAACAC
GAGGTCAGGCACCATGACAGTCATTGGGCGGAACAGTGCCTTCAGGCCTTCGGGTAGCTCAGAACGGCCTAGGTAACCAGGATTCATTGTAATGAATGCT
CCCACCGTCGGGTCCAACATCACCTCGTCGTTTTCGAGGATAAACCTCTCGTCGTCAGCTTTGCATGCATCGCACACAGCCTTAAACTGAACAGAACACA
CAGAGAGCACTTCCGGAACAAGGCGATTGAACTCATCGAAGCAACCCCATGATCCAGAGGATGCAAGACCTTTGAAAATGTTACCCAGACTCTTAAAGTC
CATCTCGGGTGAGCAGTTAAACACATAACACACTTTACCCAGTGCGTTTGCTAAATCCTTAGTCGTCTCAGTTTTGCCCGTTCCTGCTGGCCCAGCAGGA
GCACACCCCATCTGAAGGTTCAGCGCCTGCGTTGCCGTCACGTAAATTCGATCGGTCAATGGGGTAATCACAAGCCGGGGGCCATTTCCTAGATACTCGT
AGTCATATGGAATGCCTGCGTCGCAAATAAGGATCTGAGCGCGCGCGTTGTTTGCTCCACGGAAAGTGATATCACGCTTGAGGAAGCTTCCCGCGGCAGG
AGAGAAGTAATGCTTCAGTTGAGACTGCCACTGGAAATGAGTTGCCTCCTCCACCCCAGCACGAATCATATTTGCCACAATATCTCGTCCGTGGGCATCC
ATCGTGATAAGCACCATCACACGTTGTCGCTCGGCATAGGAAATATTGCTCTGCGTAAGCTTGATCAGGTCTTCTAATTGCTTCTCCTGCATTTTGTTGT
AGTTCTTTAGAGCATCCTTATCGCCTCCTTGGATGCCACGGAAGGCGCGCTCAACCTCTTGCACATAATGAACTCCAGCCGCTAGCAGGATAATCTGTGC
TGCATCCATGGGCTTATTGGTATCATCTTTGAAATTGATCCAGTCAACACGTGGCATCTCGGTGTAAGCTACAAGAGATCGCTCGATGTGCTTGAACAAG
GTCAGCCTCATAGCACGCATGATCGTCTCCAAATAAATTTCAGCCTCCCCCTCCAGCACCGGGGGCTCATAGAAGTCGACGACTTCATGGCCTACGCCGG
CCACAAAAGAGGTAGCAACAGGCCGTTCTCCAGGCCCACGATCTACTAAGGTGAGCGTCTTGGTTGCCAGGTAGATTTTGGAGCAGTGTGGCATGATACG
ATCAGGATGAGATCCATTCGACAGAATATCCAACAAGTCTGCCTCGGACATGAAGTAGAAACGTGGGAACTGGCGGCGACGTCCGTCGAGAAATTCTTTC
AGGCGATGCTTGCACAACTCCAGTTTTTCTACAATTACCTCTAGACGCTTGATGAGCCCCGGTTCCGTACATGCTTGCTGAACATTAAGCGTTTTCCATG
CCGTCTTAAGAATTTGACGAACCTCTCGGTCAATGTCTTCGAAGTCAGACGTTAGCTCAGGCAGTTGTTTCTTCACTTCTTCTGACTGGATGAAAAGTGG
CTCCAAGTAACTCCAAGATCGCTGGATGTCGCCAAGCAAAAGCACGACTTCATTGATGGATGAAAGGCCAATCTGAAGTTTGGCAACGCGAGGTTCAAAC
TCTGACTGGTACGGTGACGCGCTCATACCTTGCACATCAATTTGATGAGTCTCGAGGAGCTCAAAGTTTTCCTCCGATACCTTGAGGAGTGGTACGACGT
CTTCTTCAGCAGCACCTGGGTTGTAAGGAGTCATTTCCCAGTTCACCTCAGCCCACAGAGCCTCGAGCTCAATCAAGCGAAGCTCCAGCTCTTGTTCCTT
TTCTGCTTCGTAGCAAATTTCGTTGATATCCGAGCTGAAGTTGAAGAGATTTTTGCTCAGGATTAATGAGAGTTTCTGCTCTGGGTCTTCATCCGGCGTA
GGGAATTCTCCTGTGTGGGCCATGATACGCTTCCAGTGTCTTGGGCGCATGTAGCTCGAGGATACACATCGAATAAGGGGATGTGTCTTATCAAACGCCT
GACATTCCTTCAGAATGGACGTGTACGCATCGCTCCATTGAATACCCTTGGGAATCTTCTTCAGCTCTTTCAAAGCAGATTGCACTTCGATCTGAAGGGC
ATTCACATCCACTTCTTTGAATAAAATGTCTTGAGTTGCTTTGAAAAACGCTTTGGCACGCTTGATAATTGCCCACACAGTCTTCATTGCGTCTGCATCT
GCACGCATAAGGCCCATCATACGAAGTGATTCGTTCATAAGCTGCGGAAATCCAAAGATGGAGCACAGCTTCGTATTCTCCTCACACTTCTTCATCTCCA
TGTTCCAGTCCACGAGATAACTTTCAATCTTCTCAAGACCCTTGTCAGGCTCGAGCTTAGACGACCAGAAGTCCAGGGTTTTGAGAGTCTCCACTTTTTG
AGCAATCATCTTTTCGTACGCAACAATCTTCTCTTCCGTCTTCTCGCTGAATATTCGTGTTGGCTCCTGAGTTCTCTTCTCAGTCACAGGAATTTGTTTT
TCAACATCAATGAAAAGTTTCTCCATGTTCTCGATTTCGACCAGTTCTTTATCGACGTGGCCACCACTTTTCTTGATGTTGAAAAATAGTTGCCGCACTT
GATCCAGAATCAAATGGTTTGTCGCCTTGTCCGTTTCAAGCTTGCGAATGATTTCTTTCACCTTCCGCAGAGTATCAAGTCCTTCCGTATCGTTGTTTGG
GATGTCCTTCCGCAGGTCAACAAGAATTCGTCGGAACTCTCCGTTTCGCTTGTTCATTGTCGCCATCACGCGTCGAATCAGCTCCGGAGAATCGAAATCC
TTTTGAGTCGCAAGTGGGGGAAGACATTTCGTCTTATTCTCATCGTTTGGAGGCTGGAACACTGCTGTAAATGGTGACCCGCGAATGGGCCCTGCGATGC
CATTAAATGTTCCCGAGAAGTCTACTGATATCTCGTATTTGCCTGCTAGAGATGGTGTGAACATCACCACGTATGTGCCGTCGTTTTTGTCAAGGATGGA
TCCAACCTGCTCCACTTCGGCTTGAGGGTCATCACAGTACTTCAACGAGATAGTGAACTCATCACCACCGCAGTCACGAGGGTTATCATCTTTGTCTCGA
GACTGAATGATAAACATTGTTGGTAACTCAGCTAAACAGTTGTCGCTGAGCGCAGCAATCAAACAGGGCCCAAATGCTAGAGATTTTGGTGCTGCAGTGA
CCGAGTGGAAACGGAAGGATGTTGCGACGTTGGTGTACATTCCTCCGGATAATGAGACGCGGACCTCGGAAGTTAATGACCCGAATTTCTCGAAGCTTGG
AGCTGTCGCCTGTAGGACACTAGGGCTGAGAACAGCTCCTTGGACATCGACAGAGCCCTTCGCAACTGCAAAACGCAGCGTTGCGTTTTGGCCGGTAAAA
TTGAATCCAGTAATTTTCACCTTTGCGTTTCCGGTGATCGGCCCTTGCTTCGGTTCGATCGATGAAATTGAGTATGGCGGTCCGACGATTTCACTTGCGT
TAAGGACGTGTAAATCATTGTACCAGCGGTTGGCCCACCCTCCGAAGAAAATCAAGTGGTTGGTATTTCCATCAAACACCATTGCGGTATCCGCGCGCGC
CTTCGGAAGCTCTCCCTTAACGGGCGGATTTAGCCACACCATGCTACCAGTATCTAAAACAGTTGTGCTGTTTAGATACGCTCCCTGCGCCGTTCCTGAT
TCTGCAAGATCCCCACTGTTGCCACCGAACAAGAATACTTTCCAATGAGGGACGGCAGCAACGCTAACGCAGGTGTGATTCCAGATAGGAGAGTGCAGCG
GTGTGCTCAATAAGCTCCAGGTCTTGGTTGGCAAGTCGAAAACGAAGATGTCTTGAAACTGCTTGAAGCTGTTCCAACCTCCGATGACTAACAACTGTTC
TTTTACCAAGCACGTCTGATGTCCTGAGCGCGGCTCAGGTTTCTCACCGTCGGTTTGGATCTCTTGCCACTTGAAAGAGTGCAAGTCCAAAGCATGAAGA
TCGTTGAAATCGGTACGCCCGAAGCCGTTGCCGCCGTAGCCACCAAACACGTACATCTTCTCCCCAACGAGGGTGGCACTATGTGCACCGCGGCACTGCG
GAAGTCCCTCCCAGAATCCTTGGGCATACTTCTGCTCCCACGCCTTCAATTCGGTGTTGAAGATCCAGAGGTCGTTCATTCGCTTTTCAGCCGCGAAGCC
TCCGAAGATAATGATGTTCTTTTCAAACAAGACAGCCGAGTGTCTCCAACGAGACGCCGGAACGTCGTCATCGCTCTGAGAGCTCGCTATCTTGGACCAT
GTGTAGCCTGCCATAAATTTGACGCCATTAGATGCATTTCCCAACACGGACGGTGTTGTGGAGCCACCCTTTCCTACCATTTGAGACGTCCAGCCTATAA
AGTTCATTGGTCGGTCCTGGGGGCGATTTGTGGTCACACCCGCCGAACATGTAGATCGCAGTCTCGGTATCTGAGCTCCTCAAAGTGAAAGAGTGGCCGG
ATCGCTTGACTGGGATCTCCCCGTTCTGCTTCGGTGCAATCCATGCTAGCTCTGGCTCACACCCATACCCGATCGGCTGCCAAAATGCAATACACATTAA
GTGAACCTCTTCAACCTAACGCCAACGCATTCTGGGAACCAGAGCACGAACCATTTTGGCGTTGCCCTCAGTAGGGTATGCCTAACCAAGAAGCTGCTTT
TCTGAAGGAGTTCCTTGTCCACTCGCAACCCAAACCTTTGGTATTCCCGATTAGTACGACGCTCCTTTGCCACTTCTTGCTCTGCGGATTATACCGCGGG
AAGTAGCCGTCACAGGCAACTCTGGGCAAACGCCGGGCAGGCACCATTCAAAAGTCGCGACCAGTCGAATAGATATCGTCCGTTTCGATTGGCCTCTTGC
AAATGTCCCTGCAGCATACCACACCCAAAAGCCCCACCTCCTGCGCTGGGCGAATATCCTTTGTGTTCAAAGCGCATGCTTTTATTTCATTGCGGGCTGC
TCTGCAACCCCGCTCTTCAGTCCACATGCTCTAGACGCGTAGACACATCACCTGCAACTGGGCACAACACCCAGCCAAGACTGGAGCAGGAGGCCTCTGC
ACCGCAGCTATTCGCCTCACTCAACACCGGTGGCAGCACATGATCCGCCTAGTTGTTGAACTTGAAGAAAATAATGTCGCCGTCCTGGACCTCGTACTTC
TTGCCCTGCTGCTTGAGCTTGCCAGCCTTCTTGACAGCCTCCTCCGAGCCCACTACAAAAGTTAATCACGACGGCATTAGAGTTCACCTGAATAGAAGTC
ACAAAGATTCGTTGGTAGGCAGTCAAACTTACGCTCTTTCAGGTCAGCGAACGCCTGGACTTCGGCCATGATGAAGCCCTTCTCGAAGTCCGTGTGGATG
ACACCGGCAGCCTGGGGTGCCAGCCGTCCCTTGCGGATCGTCCAGCCACGCACCTCGTCCTTGCCGGCCGTGAAGAAGTGGATAAGGCCAAGAGCCGAGT
AACCCATCTTGAGCACGCGGTTCAGGATGGACTTGTGCGTCGGGTTCTCCTTGTAGTACGTCTCCAGCTGGCCCGCAGCCTCGAGGTCCAGCATCTCGAG
CTCGAACTCGCAGCTGAGCGGGATGACGGGCTCGTTGCCGCCGCGCTCCTTGATGAACTCGGCGATCTTGGGCAGGTACTTGTTGCCCTTGCGCAGGTAG
TCGCGCTTGCTCACGTTGATGAGGTAGACCACGGGCTTGGCCGTCAGCAGCTGCATCTGGTTGAGGATCTCGACCTCCTGGGCCGACCACGTGCCGAAGG
ACACGTCCTTGCCCGACTCGAGCCACTCCTGGATCTTGCACAGAGACTCGTACTCGAGCTTCTTCTCCTTGCCGCCGACGCCGCGCTCGGCGAGCTTCTT
GACACCGGCGCACTCCTTGGTGACGCGCTCAATGTCCTTGAGCCGCAGCTCCTCCTGGATGATCTTCATGTCACGCACGGGGTCCACGTTGCCCTCCACG
TGGGTCACCTCGGTCGAGTCGAAGGCGCGCACCATGTGGTAGATGGCGTCCACGGCCTGGATGTGCGACAGGAAGGCATTGCCCAGGCCAGCGCCCTCGG
CGGCGCCACGCACGAGTCCGGCGATGTCCGTGATGGAGATCACGGGCGGCACGACGCTGGCGGGCTGGTACTTGTCCACGAGCCAGTTGAAGCGCTGGTC
GGGCAGCGGCACCACGGCGTCGTTGGGGTCGATGGTGCAGAAGGGGAAGTTCTCGGCGGGGATGTGCAGCTTCGACAGGCAGTTGAAGAAGGTGCTCTTG
CCCACGTTGGGGACGCCCACGATGCCGATCTTGACGTTGTTACCGGGGCGGCCCAGGTACGTGCGCGTGGGCTGCaggaggggaggggaaagggggacag
agacaaagagagaaggagttagatggggagaggagagTGGTGCAGGCAGGGCAGGCAGCCACCGACCTCCTCGGTCTTCTTTCCCTTCGGCGGCATGGTG
GCGGGCTGGTGCTCGGGGGTTCTCGCGGATTAGACGTGAAATAAAGCAATGGCGCTCGTGCTTTGAGTGACTCAGGGTAGGGATTTGAAGGTTAACCTCG
CTTTTCATTGGCGGTTAAAGATTTAACCCCTCTACATGTGTAATACCTCAATACTTTTTAGTATGCAAAGAAAAGGTGTCAATAGAACCATGAAAGTTTC
ATTCGATGGATGTAAGAAGCGCAGGTCTCGTAGTCGCTGAGCTCGGTACATGTACTATATAGCAGATCTACAGGGCAGCCGTGGTGTTGCCACCGCCAGC
CCTCACCTGCTGTGCCAACCTGTCCGTTTCTGCAAATGAGCAAAGACCACGAGCACGAGGTTAGATAATCTACGCAGAGAAGCACAGCACAGTGGTCCAA
ACACGTACCAGCTTTCTTCTTTGCCGCCGCAACTCCGAGAGCGATAAAGACAACCGCCATTACACCCAGGAACGCGCCGACACCCACGAAAATGGTCCCC
GGGGCCGACGTCGAGCTGCTCAGCGTCGCGCATGAGCTAATATCCTTCACGCTGCAGTCAGTGCCGGTGTAGCAAGACAAGCAGCTGCACGACTTGGTGC
CGTTCGACTCCTTGCATTGGCCGTTACCGCCGCAGTCAGACGTGCTTTCGCAAGTGCCGCCACCGCTTGTAACCTCGTACGTGCCGCAAATGTCCTCCTG
GGTCGTACCAACACTGCTGCTCAAGGTGACATCACACGTGGCACCGGAGTCCGTGCAGACAACGCCTTCACGGCTGGAGCAAGTCCACGAGTCCGAGCTG
CTGATTTTCAGGTTGCTTGCGGAGCAGCTGCTCACGATCCAACCATACTTCGTTGCTCGCGTGTTGGTTGACTGTGTTTTGGTTTCAACGGTAGGTTTCC
ACGAGCACTTAGTGCTATCAGTCCACTCTGCGTTGTCCGTGTATCCCGAGTACTTCGCAAACATAGCCTTCAGATTCGTGTAATCCGTCGAGGACTTTGA
GCTAGGCGTTCCCAAAAAGTCCGTGCTGCCACCTACAAATTAAGCGGAACGATTAGCTTCTTAGGTCCAAAAATGTTGAGCACATTGTGTATGTGACATA
CCTGTGAACATTGGGAACAGCGAGTCCGACGCCAGCTTGGCTTCACCATACGAATAGGCCAGGCCACCCGACCAAACCGCGGTGAACTCATCTGTCTTGG
AAGGGTCTTGGTACAAGTAGGGAATCATTCCCCAGTCACGAGGGGTAGCTGAAGAAGTTTTACAACCGTACTCGCCAAAGGCCACGACGATGGGGATACC
CTGCGCCATGTTAATGTAACGCTGGTACGCCTCCGCGAACGTCGAGTCCGGGCACCAACGGTACTCGTTGATCAAGTAGATATCAATACTCTCCGCCATC
ATTCCGTTGGTCATTTTGTCGCCGCACAGTAGACCCTGGATCTTGACCACGTGGTAGTCGTCGGCATTAGAGATCTGGTTGTTACTGCTGTCAGCAGCAG
CATAAGCGAGCGGGAGAATACGAATCTTCTTGCCGTTGACCGTCATCCAGTTCTTCAAGTCTGCAACGTAGGCCTTGACACATGAACCGGCGGTCAAGTC
TGCCTGCATAATTTCGTTTGCCACGACGACACCCAGCGTGTTGTCGTACTGGGCAAAGTTCTGGATGATCTTCTTGCCGTACTCTAGCAGCAGCGCCGGG
TAGCAGGTCTCGGTCTGGTCCACCGTCTTCGTGCCATCGCCGGACGACACTTTGCCCGAGCAGCTGAGGCTCTTGGTGATGGTCGAGTAGCGGTACTTGC
CGTAGTAGGCGTCGTTATCAGGCGAGGCCGACACCAGAACGTACACGCCGAGCGCGGCCATATCGTTCATGAAGTTCTTGTACGAGGACGTGGGGTTGAT
GTTGTACAGGCGCAGTGTGTTGTACTTGAGCCCCGAGAGATTCTCCGAGATGGCGGCCTTCGAGTACTTGTCATAGTAGTCGTCGCTCACGGCGTACTCG
TACGTCATCTGCACGGCATTTTAGATAAAATACAACGTTAGATAAAAAGGAACCGCGACAGAACTGAGCTTTGCTGTTAGTGGCGGCTCCTTCCGATCCT
CGTAGCGCCGTTCGAACGCACCCCTTTGATGAAGAAGCGCTCGCCCGTCTTGGCGTTGTAGAGCTTGTTGCCGCGCACGACGATCACGCCGTCCACGGCT
GTGGCCGCCGCCAGGTGCTGCAGCGCGGCGACGGCCAGCACGGCCAGCAGCAGCAGGGCGCTCCTTCCAGTCATGACGTTCGAGGCAGGCAACAAGTCAG
CGAGTCGCGGTCCGTCGGCTCCGTTCCAGTATGGGCCTCTCCCTTTTTTCCTCCCGCCGCCGCGAACAGAATAATTTTTGGAGCGGATTTTCTACAGGGA
AACAGCTGGCGCACCCATAACTATAAGGAGGTAATACTGTCAGCGCCCAAGCATCAGCTATGAGAGGAATTAGACTAAAGCTTGGTTTGGAAGGTCTAAT
ACTTCGCACAACAGAGGAATAGGACAACGGAGGCTATCAGCTTCTGGAACAGGCGTGCGATTTGTAGGGAGCATCGATTGGACGAAAATAGGTTACCGAG
TCATGATTGGCCATTAACGATCGGAATGATTTGCCTAACACAACATTTTGGTTTAAAGAAAATCAAGTTTAGCCTGGCCGTTGCAACAAAACTGATCGAC
ACCCACGCGCTGAGCGTGGGTGTGGATCAGTGGCGCCGACAGAAGTCGGCGAGCCGCGCGTAGGCGTCCGCCAGCACGTCGTGTGGCGCCGAAAACACGA
TGCGGAAGTAGTTGTTCATCCCAAAGCACTGACAGGCGGGACAGAGCACGAATCGATTAGTTTCAGTGGCCGTTTCGCCGATGCGCGCGCAACCAACTGT
TCAGTGGATCGCGGACAGTACCTGGCCGGGCAACACGAAGACGGACTCCTCGTCCAGCAGCTTCTGCGTGAGATCCAAATCGTCCTTGATGTGCGGCAGT
ATGTCGGTGTGTACCTTCACCTGCATTGGCCAGAACGAGGTTAGTGCACAACTCTAGGCGCAGGATACTTTTTTCTCGGCGCGCTCCTTGCGTACCATCG
CGTACATCGCGCCCTGCGGCGCCACCACTTCCAGACCCGGTATCGCACTGATAGTGTCGACGGTGAACTTGGCGTTGTCTTCCAAAGTCGCGAAATACCG
CTTCTTGAAGTCGACCAGCGACTGCGCCTCGGCACTCCCGGGTGCAGGCGTCAGCAAATCCGGAATCACGCTCTGTCATTGAGCGCAACGGTGAGCTCTA
CGCTGAGCCAAGTCACGGTGCGAATTGTAGCAAGTTACCTGGACGAGTGAGTTTGCCCCCAGGGTGCTTCGTGACAGCTTGAGATAGGCTGTCCGCACGT
CTTTCAGGATGTTGCTGCGGTCGCTCACAATGACCCAACCAACCCTCCAACCAGGGATCAGGAACTGCTTGGCCAAGCCACCCACGGTCACCACCGGTAC
AGACTTCGATAGCGTTGCCATGGGGAAGAACACGTTGCTTCCGAATACCATGTCCCCGTAGATCTCATCCTGAGGAACGATACAAGTTAGGGTGGTCAGA
TTTAACAACATTTTGCAGCGAAGCTGTCCTTACGGCGATGATTGGGATCTTGTTTAGTTCTGCCAATGCAAGGATCTTTTCAAGATGAAGCTGCAAACGT
ACAGGCATATTGTTAGGTTTTGTGATCCTTAAGCAAGTGCTGCCGTCTCTTACCTTTGAATACACACTGCCACAGGGGTTAGACGGATTGTTCACCAGAA
TGGCCTTGGTATTACCATCTACCAAGGACTGCATATGCTCCAGATCGACTTCCCAGTTGCTCTCCGCCTGATGCCATCACCACACAATGCCCATCAGTAC
AGCAACCTCGATCGACAACTGCCGTGGTATCAATCTCACCTTCAGGTTGTAGAACCTGCATTCTATCCGGTTCAGTTGGCACAGTGCTTGATAGAATGGA
AACCCAGGCTTCGGAAGTAGGATGTTGTCACCAGGATCTAGCAGACCCCGCACAGCAATGTCAATAGCTCCAGAGCACCCGCTGGTGATGATAATGTCCT
CCGGTGTCAGCGGGGCTTTCGCATTGCCATAGTGCTGTGCAATTGCAGCACGGGCAGCCTCGGACCCAGCAGAGTGGATGTAGCCATTATACTGCATTGA
GCTACCAACGAGTTATACCAGTTTTTTTTTTCAGATGTATGCGGTGCACAGCATACCGAGTGTTGCGGACAATGGCATTCATCAGGACATCAGGGCAATG
CAAATTGCCGAACACCGTTGGGTCGCCTGCGAACCAAAATATTTGTTTCAACACTGAGTTCTCCCAGATATCCAAAGCACACCACATAGAGTATCACCAA
CCGAGCGACAGCGGGATCAGGGTCTTCGTCGACGTTGTAGGCATCTTGATGTTGTCCACAATTTTGCGAATTGGATTGGTGCACAACTTGGAGAAGTCCG
ACGGCTGCACATTCCACTGCAGCTGAGCTTGCTGCTTGGTTTCCACCATGTTATGAGGCGATTGAATTGTGAGGAAGGGAATACCATGCCGAGGTCATCG
ATCCGGGGCGATCATCATGCCGTGCTTGCATTGCCCTATCGTGCTCATGACAAGTGCCGAAAGTTGACCAATCGATGACGGTTATTGCCTCCCGGTGGTT
TGCAGTGTGTCTTCAAGGCAGCAATCCCCTTTGCTGGTCCACAGAGGACCATTAGAGTGGACCAGGGTGCGGCAAAATACAGGAAGTGTTTGCATACTTA
AGTAACCGTTTGAAGCCGGGCATAGTTTTTGTTGTGTAGAACCAGATGCATGAAATTCAGCAAAATAACGACTGATACATCTCGGCGGCGCAGTTTTGGC
GGAACTGCGCTTGTTTGGTCAAAAGTTGCTTTTTGAGTACCTCCTCCTCCTTACCGAGAGAGCCAAACAAGACCTCCAGTAGATCTGGCTCCAAGCCGTC
GTCCTCCCAGCATTTGGTCAAGACTGCCACGAAGCCCACACTAGCATTTGCAAGGAGCCCCCGCCAGTCTGCAGCGTGACTCGTTGCTAAAAGTCGTTGC
GTCTTCGTGAAAAGATTGTTATCCAGGGATAGCAATACCTTCTCCCGCGCGAATTGAGCTTTCTCCGCGATAATAGCTGCCACCGCACTGGTTTCGTCCA
TGAGAGTGTCGGCTTCAGCAGTTTCCGACGAGGACCGTAAGGCAAAAAGCTGTGATTCGCACTGCTGCTTGACAAGCTCTTCCAACATGACCCGAGCGTA
GTACGAAACCATACACTTGTCTGCAACAAGCTTCTCTCGCTCACCGTCCCACCAGTAGTTGACAGCAATGGTGAACGTGTCCGAGTCGACCTGATGCCAC
CAGCCCTCGGGGATTACAATGGCGTCTGCAAAGCAATCGGCGAAGGTTTAGTACGTAACCCTCAACCATCGGCGATCACAGAGCTCTTGATAAGACCACA
GTTTACCTCCGGATGTGACTTCAAAGCGATAGGCCGACGCCTCAGGAAATCGAGGGTGAGCTTGCAAGTCAGGTTCCACAATGTTCACTCGACTGTGATT
GACCGACTTGGTGTGCACCGGAAAGGGGTACAACTTTGCAGCGTCCGATGGCGGGTATAGCGTGACAGTCTTCTTCCCGTACAGGACGGCCAGAATGTTC
TGGTACGCGTCATAGTGCAGTGTAGTTCGACCAGGTTGCACAGTCATCCACAAGTTCACTTGTGAAATCGGTTTGTCTTGGATAGATCCGGGCCTGAAAA
CCGTGCAAGGAGTTAGTCAGACCCAGCAATGGCAGCGACGACACCATTGGCAAGTACCTTACAGGCGGAAATCGTTCATGATGGCTGGCAGACTCGCCTT
CGTGCAGGTAGAACCTGGTTTGAATACTGCGATGGGGCACTGCGCAAGATAAAACTCTAGGTCGTCTACTTCCTGCAGCCAGTGCGACTGCTTTCGGAAT
GCCGCCTGATAATAATCGACAAAGTCGCCAAACTTGAGCTGGACGCTTTGTCTTCCCTGCTCGTTGCCATGGTAGCAGCCGCTCGATCGCTCTTTGCAAG
CAATATCGACCACTGGCGTACACGCGCACACACCGTAAGCACAAACGCAGCCAGCTATATCCAACTACGTGCTGTTACCGGTGTCTCGATGAAACGCAAA
CGAGTCCAGCGAATGGACTAACTCCGGAGTGAACTTTGGCAAATGCTCGGGAGCAACGCATTGCCTCGAGAAGCCAGGCAGGTAGGCCGGGTCGCTGCCG
CTCATGTGACTTGAGCTCATTTTATGTGGTGCACAAAACAATGGAGCTGCGGCATCTCGTCCTCTATTAGGAAGAATCCACTGCATGAATCAAGATGGAC
CTCTAACTTGTAGAAGCGGCCCCGTTCAGTGCTATGTATGTAATTGTTTTCATGGCTACTGGTTCCTAGAGCGCTAACTTGAAGCGCTGGTTGGCAAAGG
TTCGAGCGATGAAACAGTAGCGTCGGACATTGGTTCCGGTGCTGGCTGGCTTATCGCCGTCTTAGCACCAGAAGATGACTTGGAGTGGCGCACGCAGTAG
CCATGACGCTGCGCCCACTTTTGGCAGCCTTCCTCCGCGCACCGTGAgccgccaccgtgcgctcgacagaatccctttgaaatggcgcccttcgtgcagt
cagggtgctggcagcgcacaccgccaccgtgcgtcttgcagcaaccgcgagactgcaccgcgcggtggcaaccttcaacgctgcagaatttgactccgcc
atgTGCGCTACACTTGTGGCCGAACTGCGCCACACGCTCGCAGCCAGCCTCCGCACACAAACGCCTCCCTCCGTGTCCTGAACAAGCGTTGTTGAAGCGA
GCAAACTTGGTGCAGCCCTCCACTTCACAGCGGCGGCGGCGGTACCGCTTAGGagcaggagcagcaacaggagcaagagaagcagtaggtgcaggtgcag
cagcaacaggagcagcCACTGCGTCTTCGCCCTTTGCGACTTCAGCAGCTTCAGCACCAGGCTCCATCGACTCGTCTTTCGCCTCTGGGGTTGGCGAGGG
TTTGTCCTTTCCTTCAGCCTCCTTGTTTGGATCACTCGATGTTGCATCCGTAGCAGTTGCGTCTTTCACCTCCGTGGAGGCGTCAGCGGCAGTGTCGGCG
CCACCGTTGGCCGAAGTGTCGGTTGCAGTCGCTGGCGTTTTGTCATCGCCATCGGCCGGTTTCTTCTGCTTGTCCTTGGCGATCACGGCCGCTTGAAGCA
GCGTGTCGATCCACTCGCGCACAGGGTGGCCCTCGCTGTCCGTGGGAGGCTGCGCGGCCGCTGCAGACGGCTTGGCAGGGTGGCTCTCGGCCACTTCGCT
CATTGCGCCGCCAGTCGTTGATATTTTTGCGGACGATCTGCACCAAGTCGCATGTTTCGTATTCTTCTGCATGGGTGGGAAACCACTTAGTATTTGTATC
GAGTAGCCTCAAACACAGCCGTTACACCAAACAAGAATCTTCACAGGTCGTAGCATGTCGCAGAAGTGCAAGTTGATGTTGCAGCCGGCGCTGCTAGCCG
GCGCGTTCCGCCGCCAGGCCGACCCCGACGGCGGCGTGCGGCGGTGGACGTGCGCTATCTGCTCGACCATCAACGGAGACGCGACGAGCGAGCCACCGCA
GCGTTGCAAGACGTGCCAGCGCTCGCGTAGCCCGCAGTGGTTGCGGTTGGAGGACTCAGGCGTCCAGGTGCTCAATGCTGTAGAGCCCCACAACGATGTC
GATTGGTACTAACGCATTACCACCTTAGATCGCCTTAGGATCTCACGTTTTCCACACCAGCCCCGGCGGATCCAAGAGCGTGGCGGTCGTGGTGGCCATC
AACTACACGCAAAAGGTTGTCACGCTGCTGAGATTGAAGGCAAAGCGCAGAGAGGGGAGTGCACACAGTGACATTAGCTTCCACGAAGTCACGCTCAACG
CGTCACAACTGCAGCAACAACTGGAGCCGCTGGATGCTGAGCAAGAGGATGAGTGTGTTCTGGACGACTATTGCATTTGCGGCGAGTGCCGTGCAGTCTT
CCGTGTTGCCCAGGGCGACAAACAGTCTCGGTATGCAAACGAGGACAAGGTCGCTGAGCTTCAAAAGGAGTTGCAAAAGATTGGCGAGCAGAAACAGCGA
CTCGCTAGGGAGAAGGCGTACGAACGAACCCTGGAGTGTACAGAAGAGATCAAGATGAAGACGAAGCAACTCTACGTTGCGAAGCGCGAGCTGGAGTTCC
TTACTCCCGTGTTCTGTCCATTCTGTGGGTGGTCGTGCTAGATATCTGAAAAGGAAAGTAGGGGTCGACCAATATAAAGAGAGGGATCGCTTTGTATTTT
GATAGTCCCCCTTTAAATACTCAACGAGAACGTTCGGTCCTTCAGTCGGTGTCGACACTAGGTACAGCATTGCTCCGGCATCCACGACGTCCACTTACTC
GTTGGAATCGTGGCGAACAATTATCTCGGATGCGATTGCTGCTATCTTGCTTGAATGAATATCGGTTGCTCGTTACATCACCGAGCAGCCCAACCACGAC
TCCTCCGAGCCGTTCGCTGCCACACCTTCGGCCGCATTGTCCAAATGCTTCATGGCAGATGCGATGTGCGTGTCAAAGTATGGGTGCCACACGTGGTCAT
ACATGAATCGAGCCGTGAACGAAAGATCGTCCTTATACGCTTTAGCGACCTTGGTTCCGCCCCAGACACGGCTCCGCTCTACGATCCACGGCACCATGAC
ACGCTTCGGCTTGGTCGCGCGAAAAACTCGAGGCATCACATATCTCTGAAAAGCAGTCTCCGAAAAAGCAAGCTCAATTGCTGGCTTGAAAGCTTCCTCT
TCCAATCCAAGCACATTGAAGAGCAAATGATTTAGGCGGCGAATGTCGTCTTGCAACATGCCCAAGCGAGTCTGCCACGAGTCCGCAGATGATGCTGCAG
AGAACACCAAATCATCCTCCTGCGCGATAATCACATCCACAAGCGCGAAAATAGCCTGATATAAGGCCACGATATCGCGCTTCTCCACAAACTTGATAAC
TACGAGCGGAAGAAGGACTTTTGTCTTCACGTCGTGCTGGTTTCGAACAAACTCGATGAAGTGCAGCTTAAACCAGCTGAAAAACTCGGACACATTCCAA
TTCATCGGCGACGTCAAGCTGCGACTGCGTTCCAAGAACTGGTCGATGACGTAAAGCGCATGACGAACAGGCTCGTGCAGTCCCAGAAGAAACTGTGAGT
TCCAGCTCATGTCCACTTCGTTGTTGCGTGTCAGCACGGTCGAAAACACCACGTTCTCCTTCTTGTGTGCTGGTGCAGATACTGGCGCGCTCATTACGTT
GGAGAAATCGTCTGCGGCGAACTCCCTTCGGAGCGTGTTGGCGTCCATGCGCAGGGGGCCAAGGCTCAACACGGAAGAGGTGACCACCGACGAGCTTTCC
TCGCTACTGTGCTCGGATATTGGCGTCGACAAGTTGCTGGCGGTCTGCTGCGTCTTGCTCAATATTGCAGCTTTGGCGGCGATGGCGTTCTGCTGCGATT
CCAAGGACGCCCAGATATTGAAGAACTCGGTGTCGCTCGGCCCCTCATATCCGCTCTTGTAGTCGATCGTTGTCAACACGTGCGCAACCTGGCTGATGTC
CACGAGTTGCTTCGACTTCTTGGCGGCAGACTCGTCGCGCGCGGTCTCGGGCAGTGACCAGATATTCGAATAGAAGACGGTCTCGTCACCCGGAAGGCGG
CGCGCCTTCTTGAGACTCTCGCTCTTGGCCACCATGGCCAGTCGGCTTTTCGCGAGCGGTTTGCGTTTGACGACGGGCTTCACGGACCTGCTGTGGGGCA
GTACGGGGCCGCCTCGGTGCACGGGCTTTCGCGGCAGGCGCTCTCTGCCAGGCAAGTCGCTTTGCACTTGAACTGGCATCGCTCTCCTCCCTTTTCTTCG
TACACACCCGCTTTCCTTCTCTGCCTCTCCGCTTGATAGAGGGCAGCTCAAATCCACCAGATGCCCTGCGACTCTAATAGTCGTCAATGACGGAGCGTGC
AGGTTCCGCGAGTGGCAAAATCTTTTGAGGCAGGTGACTACAAGTCTGACAGATGGGGGAGGACTAGCAAGCGAGCGCCAACACAAGTATCGCAGTGAGA
ACGAGTGTTGCACACGGCGGCGGCGCGCTTGTCAAAAGGGGAAACATGTGCAACCACCAACCTGTCTCCACAATCGTTACTGCCGCCGGTTTCGTTGCGC
TCGACACGTGAACTCAATTCACTTAATTGAGGAATGAGCTGGATGGCGGCAGAGAGACGAACGCGGGGCTCGGGGTTGGCGCTCAAGTTTCACACTCCGT
CAAGTGCGGAGACCTGGCAGCCAGGACGGCGACTTGGGGCTGGTATCAACCCAGCCAGCCAGCTGGGAGGGGAAGTCCATGTCTCCAGTTTCCAGAGAGC
GGTGCGCAGAGTGGAGGCCGCGCAAAGCCTTTGCCGCAGGACGTGGGCGAGGCGCTCGCTGCCGGCCAACCCACGAGAAAACTAATCTCAGATCCGGCGT
GGACGCGGCCCGCTTCGCTTCGCAGCGCAACGAGCGGCCCCGAACGCGGGCGAGACGCGTTCGCGGACTTGGTTGAAGCCGAGGTCAGCAATTTCGACTT
TCGGTTCCAGCAAATTGCGATTTGCGGATAACTTCAATCACTACTGTACCTCATTGGCGAAACTTGACGGGCGCTTGCTGATGCCCCTGTAACGAGGTCA
TGGCGGCAGATGCTGTGGCCGTGTCCGAGGCCCTAGTAGTCAGAGAAGCGCAGTCGAGAAAGCAAGCTCACGGGCAAAATAGCGAACTTGAACGGCATCT
AGGTTTCAGAAGAGTGAGTATCGGGTATGGCACGCAAGAATTGCCACGCGATAAATACGCCGACAAACTTCTTCGCGCCGGGAACTTTGAGCTTTGATCC
TGTCTTCAACTTCATCCTGAAGGCGCGCGTACCCACTGCGCTTCAATGTCCCGAACACACCACATTATACAATGCTATGGCACGGGATCCTTGACAACGA
CAATAAGCTTAGGTTCTGTAGCCGGATGGACCCGGCCAATGCAGTGCTCGCCCCGAGTGCAAACGGCGATAACCGTAAAAATAAAACACTAGGTTCTGCA
GCAACCTGACAGCGAAGAATGGAGTGGGTAGCCCTATTAGTTTGGAGTGGGAAATTGGCACAGAATTCACCAAAACGATCGAATAGACGCCATAGTTGTC
GCTTCACGGCCGCTATTAACCCCAGCTTCGTATCTTAGCGTGAGAAATATGCACACACATCCGTCCAGTAGCTTGGTTACCCTAAAAAAAACATTTTTTT
ATTGGGTTACCTATTGGCCTGATCATCGGGAAATCCAAACATTGCACTTTCATTAAAAATTTGAATTACCGGGTTAAAATCCAGAATATTTCCCAAATTT
CATAATGCTCTTAAACCACCCAACAGTTGTAGAGCATCTCATTTTCGTCCAATCCGGTCACGCTCGTGTACACAACACAAGATCCACGGCGTGAAGAGTC
GCAGAGTGCCCGCCCGCTTGGCGATCTTCCGCACTGGTCGAGTTGCCCCGAGAAGACAAGAGCAGACAACACCAGAAGCAACTCCTTGAAGAGGCCGGGC
GATGGGGCAGCAGGTCTCGCTTCCGGCCGCGGTGACGCAGCCGCCGGGCGAGCACGCGCAGCTGCGGCCGCTGCAGGCGCCCTACGTGCCGCTCTGCGAC
GTGCTCAAGGCTGGCGACTCGGCTGTGGCGTCCACCGCCGCCGAAGATACTAAAGACGCCATGGACAAGATCCTCGAGTTCGGCGCCGCGCTGTGCTACC
TCCCCAAAGGTAATAGTTGCTGGGAGTATTCCATCGTAGAGGCTGAGTAGACTGACGTTGAACGCTGGCCGGTGCAGAGAGCGAAGTCTCCGGGCGACTG
CAGACGCGCAGCCCCGAGCAGCAGCTGAAGGAGCTCATGAGCCCCGTGGACACGGTGGACGAGCTGTTCCAGCACATTTCACAGCTGGCTGGGCTGCCGT
CTCAAGACCCGCAGGACGGCAAGCGGGACGTCGTCGAGACGATGCCCGGCATCTTCGACGCGCGGGTGGCGGCCTACGTGAAGAGCTTGCAGGCTCTGTA
CCAGATGATCAAGAAGGAGAAGTACCGGCACGAACAACGGCTGCTAGCTGCCAGAACACACGCCATGTCGCTGCGCAAGGTGTCGCCGCCGCCGCTGCCG
CTCCCAACACAAAACTGCATGACCATGGGCTGGGACCTGGTGGTCATGCTGCTGAAGGCAACGCGCAGAACAAGCCCAGATCAGTATGAACAAGCACTAC
AGATGGTGAAGGACAACTTGAAGCCACTGAAGCCCACGGCTTACACGGACAGCATGTACCTCGCCCCGTCCGCCTCGTCGGCTTTCAATCTTTTGTGTGA
CTGTCTCGGCGAACTTGCTTACCCGGTGAACGAAGATGCGCCTGAAGGCGAAATGCACATTGGTGCTCGTACGATCGAGACCTTGGCAGAGGTGGGACTG
GCCCGCGGCTCACTTGCGACCATGCTCTTTGTGGTGCTATGGCTAATGAAACAACCGCCTACGAGTACAGTGAACTTGGAGACATCCATCGCGAAACTTG
CCGCACTGAAAGAGCAACCAATGTACGGCAAGTGCGAAGCCTCCGGTGAACTTTATAGCTGTGGGCAGAACTCGTATGGAGAACTGGGCACGGGGGACGA
CATTGAACGGCATCAGCTCACCAGCGTAGCACTTTGTGGATGGGATGACATCCGTCAAGTGGTTAGTGGGAACGAGACACTAGCAGTTCTCACGAACGAA
GGTGTCGTACTTACTTGCGGCCTAAACAAGAGTGGCCAGTGTGGTCAGGGGCACTTCGACGAGAGAGTGATGATGCTCCGTCCTGTGCAGGCGTTGCGGT
CCCAGCGAGTGAAATTCATCGCTGCAAGTAACGGATGTGAGCACATGATCGCGCTGACGGACACCGGTGTTGCATACTCGTGGGGTTACAATGACAGAGG
ACAGTTGGGTCATGAAAATTTAGCCACCAAGATTCATGTCCCCAAGCTGATCGAGTCATTGAAGGACAAAAAGCTTGGATATGCCTCGGTGAGCTACCAC
CACAGCGCCGTGATCACGAATACCGGGGAGCTCTACACGTTTGGAATGAATGATTGTGGACAACTTGGTCTCGACCACACGCAACATCAATCGACCCCGC
AACTTGTAAAGAGCCTCGAAGGCGCAGAAGTAACAATGGTGGCTTGTGGATTGTATCATACAATCATTTGTACGGCCGCGGGAGAGCTCTTTACTTGCGG
AAAGAATGACTACGGGCAGCTAGGTTTAGCTCACAACCGTCAGATCAAGGTACCCACACTCGCTGCGCTTCCAAACGAGATGGTATGTTTTGTTGCATGC
GGATACTACCATTCCGTTGTTGTTACCGCCGGCGGACGGACTTTTTCGTTCGGAAGGAACGATTATGGCCAGCTAGGCATCGGAAGTAAAATTCACCAGA
ATGTGCCAAACGTAGTGGCTCTTTCTTCCAATACGCGAATGGTGCGGGCGACCTGTGGGTGCTACCACACGGTGCTGCTTTCCGAACAGGGACATGTTTA
TGTTTTTGGACGGAACAACAAGGGTCAACTAGGGAACCGTGGTAGCGCTGACGCATTGCTCCCTGTTCCCTTAAAAGTTCGCCCGGAGAAAAATTCCCGT
CGCTGTGTGGACGTAGCTGCTGGTTTTTATACCACGTCATTGATTGTGGAGCGCAGACGTGATAACGACGATGGTGATGTTGTAATGCTGGATCAAAGTT
GCGTCGTCCCAGTTTGCGGTCGTGTCGACATTGACCGATCAGGAGAGATCGAAGGGCTGAGCAACTTCGGATCTATTTCCACAATTGGCGTATCACTCTT
CCGAGGCAAGTGGTTTTACGAGGTAGAGGTGGTGACGAGCGGGTTGATTCAAGTTGGATGGATCGACGGTTATTTCCAGGGAAGTTCAGACCAAGGAGAA
GGAGTTGGCGACCATGCTCACTCGTGGTCTTATGACGGCAATCGCCAACGCCGCTGGAACAGTGGGTCATCTTCGTACGGGGAAAAATGGAAAGCTGGTG
ACATTATTGGCTGTTTGCTTGATTTGAATACTCAAGAAATGACATTTTTCCGGAATGGGATTAGTTTGGGCGTCGCCTACTCTGAATTCCAGTGTTCTGT
TGACGACAGGCGGTCGGGTATGATGCCTGGTATCAGTCTTGAACGTGGTGAGATTATTCGCATTAACCTTGGCCACCATCCTTTTGCTTATCCCCCCGCA
ATAGGGCACGATTTCGATAGTATTTCGCGTGCAGTAATGATGCCTTCGTCTAATGCAGTTGTTCACTCGACCGTAGAAGATATACCCGAGGGTATTTCAG
CGCACCCCCCACCCTTAGAAGGATCTGCCTCAGCTTTGGTAGGGAACAAGTTGTTTGTCGTCGGTGGGATGCTGACAAACGATATTGCTTTGCCCCAACC
TACTGATCCTACAAATCAAGTTTGGGTATACGATACAGAAACAAAAACTTGGGACAGGTGGACTGATTTTCCAATTGGAATTTGGCACCACCAAGTTGTG
GCTATCGATGACAATCAACTCCTTGTCCTAGGCGGTGAAAACAACTGTGCAGCATCGCGGCACATGGACATATACAAGTGCTCGATAGTGAAGAATGCGG
ATGGATCCCTCCCAGCATGGACATTGATCCAAGCTGCCATTGGTGCAGCGACATCCATGCCCCAAGCGCGTGCATTCCACACAGCCACAACAATTCGTGT
TCGCCTTGACACGATTGTGTTTATGTATGGTGGAAAATCGGTCGACAATGAAGTTCTCGGAGATGCGTGGTACCTATCCCTCGATGACTATGCGTGGTCT
CGGCTACCTAGTTCTGTATCACTAGATCCCGGCCCACGAATAGGATGCTCCTCTGCAGTCATCGGAGAGTGTGTGTACTTGTTCGGAGGACAGGACCGTG
AAGAAAAGTTTAGATCAGATCTCTGGAGATATAACACTTTTGATCGACTCTGGCACTTGTGCCATGACGACAGCATTGGAGTTTCCAAAGACGTAGCAGG
CGGCAATTTGAGAAGTGATTCTCAACCGATGTTACCAGAGGGAAGAACCAGCTACAGTATGTGCTCTGATCTTGGAAATATTTGGATCTTTGGGGGGGTT
ACCCGGTCAAACGTCTTTTTGTGTGATCTTTGGTACTTTTCGGTGACATCACAAAAGTGGAGCCGAGTGGAAGTAAATACTCAGGGAGATATGGACGGCT
GTTGTTCAGCAGAAATGTATGCCCGAACTGGAACAGTGACAGCTCTACCTAGCCTGTCTGATCTTGAGCCATCTACATCTGAAAGTGGCAGCTTGATTCT
GTGTGGAGGACGAATTACTATTCAAGGGAAGGTGGTGAGCTGCAGCGAAGTCCGGAAGCTATGTGCGGTAAACACCTCCGGTTCATACAGTCTTGACATG
ACTAAAAGTATCTCGACAACAGGAAAAGCAGGGCACATACTTGGCGCTCTCCGTGCAAAATGCGGTGTTGCGAACAGATCAAATCATCACTGTGCAGCAG
AGGCCTCAGATTCAGCCGTGTGCTTACTATCCCACCTCGACCGTTTAGCTGGAAATGATATCCCTGGGGACGATGTAGACTCGGTTCAACTGTCGAGGTG
TCCTTATCGATCTCTCTGTATTGACCCCAAAGAAGCGACATTTTCAGCCTTGTACTCACTGCTGGAGAACATAACGTCACATTTTTTTGAGATGGATGCA
TCAAATGATGATGCAGGCACCGCATCACTGATAACCCATGTTTTGTATCCAATGCTTGTGGCAATCAGGATCCTGAAGCTCAACTTCTTTGAGGTACCTA
TTTCGGATTATTCCATATTTGAAGATTTTCTTTCATTTAATTATCTCACTATCATAATGCTGCTTTCTTATTTAGTTTTCACGTAGTTGTTTAGATGGAT
CAGAGCTTGGATTACCGCTAGCAGCTTCCCAGGCTGGTGGGATCCTTTGTTCAATTCGTGAGCTTCTTTTCTCAATTGCAGACCACGTTCCGAAACTGCT
ACTGTCTGGAGAAACACTGTGGTTTTATCACGCAGTGAAGCAAGAAACCGCATCCGCAATCTGTCATGGATTTTCAACTTTGTTTCCCTCCCTTTTGGAT
AAATTGCAAGTCATGAACCGCTTGATGGTCAACAGGCGCAATTCTGAGACGGACTTAACGCCAGCACAGAAGCTATTGATCCCAATGCTGGTACCAGGCT
TCACGTCAGCAAAAATGTTGTTTCAACTCATGACAGACCCTGATGTACTGTTCAAAGTCGATGGCTCGGCAGATGCTGTTGTTACTGAGACTGTGATTAC
TTTCATGAGCACTCTATTGGATGGACTTTGGGATCATACGAACGATGTGGTGAAGAGTTCGTCAGGCGATGTCACCAGTCTCATGAAGAGTTTAGACACT
ATTGAGATGAACCATGAGTTTAAGTGTCTAAATGTCCTGGTACGCGCCACTATATTCTGGTGTTCGTGTTCCGCAAATCGAGGCTGGGTGATAATTGAAT
CGATTTGTACGAAGTTGGTGCCTTGCGTTTCGGAAAGGCTGGACCAATGTGAGACAACGCAGCTCGAGCAGACCTATCTTCTTCCTATCGTCATCCAGCA
CAGCTTCGCCGGCAAATTACTTCCAGCTATACTACTTAGCATATTTTCATTGCCTTCTGTTCGCAGTGCACTCCCAGCTTTGATGGACCCGTTTTGGTCC
AAATTAGAAGTTTTGTCAGCCAAACTGCACACGACACTTGCGGTTCTTAGCAGGCGAGGTATTTTACATCCTACTGGGATCAACCTGGAATCACCCACTG
AAATGAGAGACCACTTCAACGAAGCAGATTTTGTGGATAACGCGCTAGCATCCGTGTCTAAAGAACTCTCGCTCTGCATCTTACAGCAACACACCAGTTG
CTCTGCGACTTATGGTCAGGTTTTAAAAGCCATGTGGGACAAGATCATCCACTCCAGCGGATACATGTTTTGGAAAGTAAAAGATTTGACACAGGATGCG
GAAATCCGACGGATGACTGTTCCCTTGGATTTGGCAAAACTCTTTGGGACGGATACATTGCTTGTGAAAGTTTCAAAAACTGAAACTGAGTCTGATTTGG
TAGAATACGACCCACGTAAAGTTACTTTCGCGCCCAGTCGGACTATTCTTTCGCAGCATATCTATCCTATAAGCGAGGGTCCGTTGCCAGTGCCCAGTAA
AACCGACAATGATGCAGTGCCACCCCCAGCGCCGCATTCACTCAAACACAATTCTTTGACTATGAGTACGCGCTGCTCCGACAAAACCATTGAAACAAGC
CACGAATGGCTGAAGGATCTTCAAAAAATATTAGCTTGGGTCGGATGTCACTACGCAGCCACTTTGATTGTCGGTGCTGAGCTGGATACAAGCATTGGTG
TTAGTGAGCGATGGCTGCACTCTCCGCTATTCCGGGGTGGACTGGAAGCTACCTCACCTGGGACGGAGTACGAAAACAATGAAGTGGGCCGCAATGAGAC
GCTTTTGCTGCAAGTGATAGACAATGTTGGTAATGGCAAAAAGCTTTTGGACAAAGTGCGAAACGCAGTGGATCCTGGATCGGCTCCAGGTGGCGCAAAT
CCTCAACTTCGAGTTGCGAGGTTGAAGAGGCAAGATAGCGTGGAAGCAACACTCGAGAAGAGCGGTGGAATTGAGGCAGTGGACCGTGCTGTCCGCGCAA
CATTCGCCGCGCTTTTGAAACATACCAACATATCGTACACAACAGAACCTATCTCGAACGAAGGAGCCCTAGCGGAAACCGTTGTTGATGCCTGGAAGGC
TGCATTACAACTTCGTCGTTGGTACATTTTCTCTTATGACTTCTACTATCGTATAGGGTACCCATCTAACTTAATACGTTGCCTTACTATGCTTTAGGAT
CGTGAGAGAACAACAGAAGCTGGCTGCAGTGTTCAGGTAGAACCCTTGACTATTCAAATCTTGGTGAATGCTGGCCCTTAACTGGCTATTGATTTTATTG
TAGCGAGACGGGAGCCCCAAGCGGATTTTCTCCTGATATGGAACCAAAGGAGAGGCAGCAAGCACTTTATAACGCTGTCTGCGAACCTATAATCCGCAGA
GCTCTGTTGCTTTTAAAATTAGCACCTGCGCCGATCCAAACTGCTCCTTCAGCGTCTTCTCCGATGAAACTTCTACCTGGAATTTCGATGGCAACAACTT
ACGGTAAGGTTACTTGTTTTGTGTTGGCCAGTCAGCCTTATGTAACTAACGAGGTATTGCTGTCGCACTACAGACTTTTCAAAAGGTTCTCCCTTGCCGG
ATACTACGTTGGAAGAGCCTGAGCAAAAACGTTTTACCCGACAGCTAAACAAGCTGATGGAAACAAAATCAATGGAAGTGATGGAAGAAGAAGATGAACA
AATCCACGCGGACATTTTCTCTTTTATTCAGCAGTCCAGCAATAATTTGCTTACTTCCACCCCGAATGATGAAGAGCCGATTCACCGTCACCCTGAAGAC
CTGATGCGAGATATTTTACTTATTCATCAGAAACGAGCGATGAAACGCTTGCAAGGGCTCAAAACGTTTGCCCGCCTGCTTCAGTGCACCGAAAACATTC
CGAGCTCACGGCTTCACGTCATTCCCATGCTTTCGTCTGCATTTAAGCGTGTGCGCACGAGTAGTGGGCAAGCCGCGGCAAACCTTTCAATAGGGCAAAC
TTCTATTACCAAGGTTCACTACCTGGTTAATTTGGAATTTGCTGGGCCTCAGCTATCTGATGCTATTGGGAGAGAATTTTTCCAGCTATTGGATTTCCTG
CTGAAGTCGTCATCGACCCACCTTCGTCAAGTCCAGCAGTTCATCGAAGCGGGGTTGGGTACTGGGTCAAGTGAAATAAAGGCATCGTCGGGTACAATTC
AGCGTGCAGTGCACGATATGCTCCTTGTACTGGAAACTTGTTGTTTCCCTTACAGAGGCGACGACTGGGACCATCTGCAGCGTACTAACTTAGTATCGTT
GATAACAGAACTTACAAGTTGGAAAGGCTGGCAAAGTTTTATTCAATACGACGGATCGGATAGCTCGCCGACGGACGTGGATAGTACTGAGACGTATAGC
ATACTTCCGGCTGCCACAGGGTCAAAGTACCCGAACATAATTTGCTCACGGTACATCACCCTTGGCACTGATCTTCGCAAGCTTACGATTACGCACAAAA
GTATTGATGGAAACGACGACAACGTGCGGGTCACGAACAAACCCCAGCATTGTGGTGGGCTTGCAGTATTTGACAAAACTTTCCACAGGGGCCGTTGGTA
TTGGGAAGTATCCGTACGTTCCTTTGGAGACATTCCTGTATTTGTTGGTGTTACCACGGGCACTACAGACCTCAATACGTATACACCAGGAGATTGTAAT
CTATGTGGATTATTCCTCTACCGCGAAAGTTGCGGTAGTGACATGATTGGATCAGGAGGAGTTCGGTGGAATCGAATGGATGTTCTTGGTGTTTTATTAA
ATTGTGAGGAGCGGCAGGTGGAGTTTTACAATGGCGAGAAGAGATGCTACGTGACAACGCTAACCACAAGTGATTTGGCTGGTTGCGGCTACTTTCCTTC
GATCGGAGTTCAGGACGCAGATGTCCACTGGAATTTAGCACCATGTATCCCGTCAAAGCTCTGGTGCTCAAGTTCCAACTTTCAGTTTTCTAACTCAATC
GTTTCTGGAGGGCTCGTTGCAGCGCCACTTGATGGAGCAACTATTAGTTGGAATGGCAAGCTCAAGGGAGTTCATCTGCAACTCATGCCAAATGGGACGA
CAGTGGCCGCCGGTGATTGTAGTTCGTCTGACGATCAGTACGAGACCATAGTTGCAAGCCACGGTTTTCAAAATGAAAGCATTTTCGTTGAGGTCCGAAT
TGTTGCAGCGGGGAAAGACGGACGATCAGCCCTTAGTTTTGGTATTGTAAGCAGTGACTTCTCGGAATTTGATGCCCCCCTTCAAGATAAATTGGACGTC
AAGTGGAAAAGTTCGGAGGAGGTATTTGAGTGGGGAATATTCGGGGTTTTATTTGATTTTGAAAAGGCAACCGTAACGCTGTACTCTGATCGCTCGGATC
CTGAAATACATCGTGTTAATGCTACGACGATGACAAGACCACTGTATCCTGCAGTATCCTCGCTTTGCAACGGCACAGTGTATGATGTAAACTTTCATCC
ACGTCCTCGCCTGGAGTTACCACCACACGTATTTTACCCTGCAACAAAACTCCAAAACTATCTCATGTCTTCGTCTAACGAGCTACAACTGGGAAAGAGC
TTGCAACTGCAAGTCCATTCGTGCGATGGCGGGGAGTTTAGCAGCTCCCACGCTGCTCGCAATTGCCTTTTGGACGATACAACAGTATATAGTTCTGCAA
AGGGCGCAAACGTAAACCTGGTGCTGAAGCACGAGGTTGACACACCCATGTGTGTAAGCTACATCAGTATCCGAGGTCCTGGGCCAGGTTACTCGAGCCC
ACTTCGTTCCGCCATCGTTTTTGTCTCCAGCACTCCTCCTGATCTATCAGACTATCAGGAGTTTGACAATATGACTGCGGAAGAATTTGCAGCGTTGCCG
TTTCCACCAAGAAATGGATGTTGCCCACGCAATGAAAGAGTACCCGTTGCATTCTTTGTGTTGGATGGCAGTTGCGCTCAGATTTCGAAGCAGCTGGCCT
ACCCTGTTATCGGTCGTTACATCATCGTTAAAGCAATTTGTCCGTCATCAGGCACAAATATTGATATCGGGTACCTTGGGTTCTGCGGGATATTTGATCG
GGACAATGGTCCTGCGTACAATGAGAGCACAACAGGGTCCTACAGCTGCGAGGAATGTAAGAAAATGCCACTATGTGGAGCATATTATGGACAGCGAGAT
GATGACAGCGTTAAGCTATGCGCTTCCTGCTATGATGATAACCGCGGTGACCTAGATTCTGCATACTATGTCTACACATCAAATGAGTCCCAGGACGACC
AAATGGATGGCAATACTTTGCTTTGTCCCCCAAGAAGATTGTGGAATGATAAAATCGCCGCGGTAAGCGATATCTTGAGCCGGTCAAAAACGCCGAGCAC
GACGGCTGGTAATGGTAACGCGGGTGTAGCAGCATCAGGACAAGTCAGTAGGTCTGAAAGGCTGCCTAGTGTGGCCAGCTTTGACGATTGCGAACTATTC
TCTTGCGGTCAAAATAACTACGGTGAGCTGTGTTTGGGGCACTGCAACTCAACGAGCAAGTTGGAGCACGTTCCTTTCTTCTCTGCGAAAGCCATTCGTG
ATATCGCCGGAGGAAACGAAGTTCTAGCCGTAGTGATGAAGGACGGTGCTGTTTTCACCTGTGGACTCAACAAAAGCGGGCAATGCGGCAATGGAACATT
CGAGGAGCGGGTGATCATTGCCACGCCCGTTCGCGCACTTAGTGGGGTCACCATTAATATGGTCGCTGCGGCAAATGGATGTGAGCACATGCTAGCTGTA
GCTTCAGACGGTGCTGTTTATTCTTGGGGATACAACGACCGCGGACAGTTGGGGCTTGGCTCGACAATTTCGAAGAGCCATACACCCCGTATGATTGATA
GTCTCCGTGAGAAGTATCACATCACAACTGCTGCTGTAAGTTATCACCACAGTGCTGTTGTTTCCAGCAATGGCGAGTTACTCATGTTCGGAATGAATGA
TTGCGGGCAATTAGGTCTCGATCACACGCAACATCAGCACACCCCACAGTTAGTTGATTCATTGTCGAGCCAGGTGATCACTAAAGTAGCGTGTGGACTC
TATCATACCATCGCAATTACCAGTGGCGGTGAGGTCTATTCCTTTGGAAAGAATGACTACGGGCAGCTGGGCTTAGGCCATGCAAGAAATATGAAGATGC
CAACTTTGGTCAAAACATCCCTTGGTGAGAGCGATGAGAAGATTGTAGCTGTTAGTTGCGGTTATTATCACACCGTTACTATCAGCGAGAAGGGCAAATT
AATCACGTGGGGACGAAACGACTACGGACAGCTTGGAATCGGAAGCAAAGACCACAAGAATAGTGCACAGTACGTGCCACTGCCTCTATCGTCCAAGATC
AAAACCGCATCATGTGGGTGCTATCATACACTCATTTTGATGTCAAATGGCCGCGTGATGGTATTCGGGCGCAACAACAAGGGCCAGCTCGGAGCGGGAT
CAAGGACGCTCCCATCGGCAGATCTGCCCCTACCCGTTCCATCTAACTCACTGGCAAATGATGAAGTGGTTCGTATAGCAGCAGGATTCTACAGCTCCTA
CATTCTCACTGGACGCTCAAGCGAGGGTTGTGGACTTGATGGTGTGCCCGACGATGCGAGTCAGGCAAAAGACCTTCCAGAAAATAGCTGTCTTGTGAAC
TCAGACGCACTGTTTGAGTCATTGATGAAAGAGATTGATTCGAAGCACGTCTGCGATCCCACAATGGCTAAACGGACACCACTCCAGATCAAGCGAAGCT
ACCCGCAACGTAAATTACCCCTGGTAAAATTGCATGCTGCTGCTTGGGCAATGGCCCGCGCTCTGATGTATCGCTCCCTCCAAGATGCCAGTGACAGTCG
CAGAAGTGAATCGGCCTCTACGAGTAACCGCGTGAATCCAGTGCTATCCATGTTCATTAGCTTCTTGTTGAAGAACTTAAAACTGCTGCAAGATGACCCA
GCTGTAAATGGCAGTGCAAGCGCAGCGCTAACGATAACTCACGAACTGGGTTCATGCGTTTCGTTAAAGCGCGTATGTGTTGGACTCTTGCACTACTTTG
GAGCCAAACTCGCTCTTCCTACTGAGGTACCTGGAGCGATGCCTTCAGACGCTCTTTATGGTCATTTCTACCGGAACCAGACCCTAAGCGTACTTCTTGC
GTGTGGCTCTGCGAATACTAATGTTGGCTCCATGATTGCAGCTAACCCCGAGGTGATAGCTCATATTATTAGTGGAATGAATTCGCCCGACTTGGCGTCA
GCTACGTTGTGTATTCGACTAGCAATGTTGGTATTCCCCCAGCATTCTGTCTCAGCGCTAAATAAGATCCATCGAGGGCAACATTCAGCTCCAGTGTTCT
CCGGAGATATCATTGCTATGCTGATGACATTGGTGGGACGACCGCTTCTTCTTCGCCCGCGTCTGTGCTCGCATGAGCTCGGCTTAGAGTGTTCAAGTAC
AGCTCTTTGCCACTCAGCACGGTGTCTGAAGGGGGTTGTTGTGAAGAAGGAAATTGGAATTGCACAGATCCAGCAGATCACCCTCGAGAAAGCTCATATT
GCCGAAGCAAAAGGAGCTGAAGTCGTGACACTCCTACGATATCTCACTCTTTATCCAACGTGGAAGGTTGCTATCAACGCTGGGATTAGCCGTGGTTTTG
CGAAGTCAACCAGTGTTGGCGAACTGCTGGACACCATTTGCGGTTACTACTCCAACATCCAGAAAGCCGATGGCATATCACACCAGACCGGAGTCCTTGA
TAGTAATAAAGGCGGCAGTGATTCCACCTCTCTAAGAAAGCCCGAGTCAACTGTATCATCACCTGAAACTGATGAGTCGATAAATAACGCATCAGATTTT
ACTACACAAGCCGAGGATTCGGAATCACAAGCTACCATTCGTGATAAGCATTCTCTAATGCTGTGGCAAAAAGCAAAGGATGCTATTGATGGCTTGGCAA
CAGTTGTAGCAGCAGTGAGTATCGTTGGAGGGCATGTCGAAGGATTTAGGGAAGGTGGGGTTGTTTCACTAGAAGATACTGGAGCCCAAGGATCGCCAAC
GCTAGGTGTCTTAACTGGGATTTCGCGAGATCCACGCACGGCTGACCTATTGGCACATGTTGTTGTCGAGACGATCAATGAAGGATCGGATTCGCCATTG
ATCAAGCCTGACGCACGAGCACATACATTTCTGCTTACAAAACTCCAAGTTGTCGAGCCCATCCCGGCTCTTGTCGATATGTTTGATGATGTTGAAAACA
TCATTACGGCTCTTTCCAGAATGATGTCCGCCACGTTTGCTGGTGAGGAATGCGGTATTCACTGTGATCTGGATCTGCCTCAGAACGGCACTGTCCAAGA
AGTGCTAGGAAGCCGATTAAAAATGTACAAGCAACAAATTCGGTGGAGATCTTCCAAGGCACTGTCGTCCATATTGAAACAAATCCCGACCTTAAGTTCG
TCGCTTATGAGTATGGATTCTCAACTCGTGCCAAGTCTAGCCGCGTTGCTGTCCTCAGAAAATTCACTGTTGTGGGCAAGCAAATCAGACGTTTCGGGTC
TTGAAGCATCACCTAGTCTTCAAAAACGATGGTTATGTGTTAAGCAGCGGCAAATCTTCCTGGGTACAGAGGAGGTGATAGACTCAGCACTCGATCAATA
CGAAACTGAAATGCGGGACGAAGTAGTCCAAAAATTAGGGAGTGAAAATGCTCTAAGTTGGGGAATGGATGCCATTCAATCGCCTCGGCGCAAGGTTAGC
CACCCGTCGTTTGCAGGTTCTGCTTCCCTGGGTTTCGGTGCAAATGGTTTGCGTGGGGCTACTCAGCGCTCTGACAGATCAGGTGAAGGAGACCTTCCGT
TTGGTGCTTGGGGTGTTTTGCTGCCACTCCCTCCACTAAATGAGACTGAGCACGGCCATACTCCTGGTGCTCCTGGGCATTCAGCAATTGATTACACGCC
TTTCCCACTGACGGCGCCAATTGTTCGGGTGGGTCGTGCCGCAGACGCTTGCGACCTCATTGTAAACGATCGCAGCGTTAGTGGCCGTCACTTCCACCTG
CGTCGTTTGCGACGAGAAGCTGACGGAGCAGAAGAACAATTTGAACTTCAAGATTTCAGCAAGAACGGCACCATCGTGAACGGGGTACGGATTCATGGAT
CCAGCACTCGGATCACAACGGGGTCTCGAATATCATTAATTTTGTCTCGGGGTGGTCTAGTGACATACGAGTTCCAAGTCCGGGCATCGGGAGGAGGTCG
CCATGCACCACCTCCGATAGTCACGGCACTGCAGAACCCAGGTGATCTTAATATCTTAATTCCAGGACAAGAGTACCAGCAGCCGCAAATTGGAACACCT
CAGATTGTGCCAAGGAGTCCTGCTGAGCTGCAGAACCGCGGCAGTCGGGGAAATTCTACCCCCTCGGAGGGTCAACTTGACGGGCGTAGCAGACAGGCAG
CGACGCAAGGTTTGCGTTTAATCACCTCTGTTGCAGAGAGTGATGTCCCTCGAGCATTGATCTCTCCAAACCCTGCAGTGGACTCGCCTCGGGCTGGTGG
ATATACTTCACCTCGCTCCTCCGTGCTTCAACCCCCCGGTACCCCTGCTGTGGGATCGCCTACCGCAAATATGTATTCTACAATGGTGCCACCCGGAATT
CTTTCCCCTGCTTCCTACCAACAGCGCGAAAGTTTTGCATCAAATGAATCAACGGGGATAACATCACCGCGATCCCAGGAAGGAGGCGTCGGTTCAATGC
TTCGTATCGCGTTAGGTCGTGACAGCGTGAATCGTGAATCATCGTCGCAGCGACCAAGTATCCCGAATGAGCTCGCGAAGACACGCGTTTTACGATCAAG
CGGTGACACCGGTTTAGCTACGCGTTCGGTATGTTTACTTTTTTTGCTTTCGGTGGATGAAGATATTGAGAGTTTCTTTGGGGGAGAGGCGTGCTAATGA
CTTTCTGCTGTATGAACTATATACAGAACATCTCGCCAGGTTTCCAGGAAATACAAGTGCTTACTTTGCGTCTTCTTGCCCGGGTTCAAGAAGCGAATTT
AGTAGTCAGCGCTACCGAGTGCGAAGAAGCTCTCCGCATGACAGCCGGTAATATGGATGAGGCCTATATGGTGATTCAGCAGAGTCGGGGTCCGGACTCG
GTGAGTATCGACTACACGTGCTTTTGCTATCTACATGTATCAGAATCTAACGCTAACCATTTCCAGTCGATTGATCCTCAGCGTATCTACCCTCAGAATG
TGCGCCATTTATCAATGGTTCTAGGGAGAACCGAGCCAGTATGCGCTGAAGCACTTCGCCAAACGGGTAACAGCTATGGTGATGCCTTGCGCTTGCTTTT
ATCGACTAGTGGTGTAGAGCTGGAGAACCCAGCGCTCTCACCTAAGCACCAAGACACTCAAACTCCAAGGGATACGAGTACATCGACTTCGGGGACAAAT
GGACCAGTAACAACTGAACCGCTGGTTAACTTCCAAGATATTGGCGACGAAAACCCAAGTTATGCTCTCACAGAATCCAGTGCAGTATGTCCCCCAGTAC
CTCAGCGTATTGGCGTCAGAGCAAATGGTAGTCCAGTAAAAACCAAGAAGCTGGAAATTCCGGGCAGTGCGTGTCTGGAATATTTGCCGGCCAAGTCGGA
TCTGACACTCTGGAGTGAATGCAACAGCAGCTTCGACGATGGAGTTCGACAGATGAATGCATTTGAAATCAACCTGGAGGAAGAAACTCTGTGTGAACGT
CTCGCCGCTATTCACGCACGCATGATTCTTATTCAAATTGTGAGGCTATTTGATAGCGCATCTCAAAATGGAGACGTACAGCTTAGCGAGCTTGGTAATC
CTGTGGTACTTCGTCGGTTAATTTCGCTCTTGAATGCACCCAACCAAAGCAATATGAACGTAGGATACGACCAGGGGTATCAGCTCCACCAACAGCTGAA
GGCACAAAAAAGTGGGAAGATCCAGCAGATTCTCTCGCGGATGGCACGTGAGGTGATGGCACGTTCACCATCCCAAACGTTGGCTGGAAATCTCAGCTCC
TCGCAGAATTTATCAACACTTCAGCGATCAATCGATCAAGTGATAGAACACCCGACTCGAGTTGGCTGGGCAGGCATGACTCGGCTTGTTGAATCACTTG
TCGTGAGTGATCAGAACAGAGTTAACGCAGGGGAGGATGTTAACGATCAGGGTCTCTCTAGCACGCTGGAGAATCTCACATTTGAAACGATACTGCACAT
TCTCTCTCGTACGTATGCTGCGCCGGTTGCGACACTAAACTGGGAGAGCTCACCTCTGCGAGTCCGCAAGACTGATGGATGCTTTCCCAAGGGGCCAATG
CTGCTTTCATGCGGCCTTGAAGTCGTCGTAGTTGATACGTACGAACGCTTATGGAGTATTCCACCACCAGACCCACTGCTCAAGCATCGTCATAAGTGGC
GGAAACGGTTTGAATCTTCCATGGTTAATGACAACTGCTGGATGAAGTCAGTGGCAGATCACGCGGTAACAATTTGGAGACCGACTCTGCCAACCGCCCT
CGAGTCTACAACAACCAGCCCAAACAAGTGGTTTTGCTTGGGTGACGTCGTAAAGTGTGGTAATGGAGCTCCAGATGCGCCTATGCTTTTTATCAGCGAT
TCCGATGATCAAGGTCTCTTACTGCCGCCTGTGAGTTTTGAACGGGTTGATATTACCGGTAAAGGCCTGCCCCGAAATTCAGAAAGCGATCCGGATTTCC
ACCGCAAACAACTACGCTCGATATGGTGGCCTGTTGCGCAGCCGGGGTATGTGGCGTTAGGCTGCGTAGCTGGAAGCAAGGAAGACCCTTTTGAACCACC
AGAAGTTTCTAGTATACGCTGCGTACGTGAGGATCTTGTGAAGTCCGTTGAGGTGTTTCATTGTGTCTGGCGAGCGGCGTCACCTGCATCGACAGGAGGT
GGCGGTGTTGAGCTTCCTACAACGCTTGAAGTTGAAAATGAGGTTCCAAATGAAGAGAATACGACTGGTGATAACGATAGCTCTGGCCTGGTTCCACGAG
ACCGTAGCACTAAAAACCAGTCTATTGACACATCTCGGATGCAGCTACTGCTGCCAGTAGCCGATGATGTCGTGGTGCAGACTTCTCTCTGGGCAGTCGA
ATCCGATTTCAGCAGTGGTCTACTCTTACCTGTTGTCACACTGAATGACGAAAATGCTGGTGAGCCCAGCTCTGCATTTGCACTGAATCTCTCGGACGAA
GATCTGGTTCTGTGCGCACCAGTTAGTGTGGAGAATGTGCTCTCTTTCGTCGAAGTGTTATTGATGTACCAAAATCTGCTCGTTAGCACGTTTCAAGAGA
AGCCGACAACGCCAGGACAGTTGCGGTCAGAACTCCCGGCAGCACTATTTGCGTTGGTACAGCAAGTGCTACGCGAGAATCAACCTTCAAGTGGGCAGGC
TGCCGTCTCACTCGTACGAGCACTTATTACGGTGACCCAGCGTGGTGCACACTGGTATGACAAGCAAGCTCTTCTCTACTGCCGTTCCAAGATTATGGCT
CTTAGTCAAGATCAAGATGGCGGCTTCACATTGCACGCTCTCTTACAGGCCTTTGTCGAGTTAATGCTGGCAGTGGAAGACCAACAACGGGGTCAGCGTG
TGCAAGAGCTTGCAGCTTGTCTGGAACGTGACGGTGGCAATTCACTGAGCCTACCGTATCGATTTCACTTCTCTAAACAGCCTTTCGTGGAAATGCTGGT
GAGCCATTCGTCAAAGATGGCAGTTACTCGGCATCTATCGGGAGAAGAGCGTAAATTCTTGTTGGACTTCCGAGCTGACGACGGAAGTAATGCAGCAGCG
CGGGAAGCACTGGCAGCTGAGGGCCTTGGTGTGCCACCCGGGGAGGTGTATTCATGCCGTTTTGAGCACACTCCAGCACTGGTGATGACGATGCAAGATG
AAGTAAAGGCCGAGATCGTATATTTTGAAGTAACAGTCGTGGAGTGGAGTGCCAGTACGAATATGGGTGGCTCGCTCGCTGTAGGGTTCTCACCCCCTTC
TTTCCCGCTTGAAGGGGTATTAGTTGGAGGCAGTGCTGATGGCTCCCGGTCGTATTCGTTCGCTCCGGCGAATGGTCAAGTGCTATCTGCAGGAGATACT
ACCGTGGATCGCTGGCGTTGGGTGGAGCCTGCTGGTGCAGTAAGCCCCGGTGATGTGTTTGGCTGCGGTTTACGCTTGGACACACAAGAGATCTTCTTTT
GTAAAAATGGCCAGCTATTAGGTACTGCGTTCTCGAGCATTCCACGTCCTCAGCAGCTGCACCCCACTATTTCCTTTAACGCAGATTGCAAATTACTGGC
TAACTTGGGTGCGACAGCAACTGCGTCAGCGAAGAACGCCAACTTCAGCTTCCGGTTCCACTCTTTAGATTGCGACAACCTTATGAGCGCCTTCGAGTGG
TTCGAGCCGCTGAGTCAGGTTTACGGTGTGATGAAAGCACTTATGGATCCAACGAGACTTAATGAAGTAAAGGGAGGGGAGGAGGTGTCAGAAAGCAACG
ATGCTGGGGTAGCGGCTCAACTTCCGGATGAATTTATGCTTTCAGCCGACAACTTTTTGTCAGATATATCGGAGGATGTATGCATTCGCGTCGAGAGTGC
ACATCCTTACGATCTTGAGCTACAAGAATCTCTTGTCAGTATTCCTTTGGCTACCAGTATTCGTGTCAGACTTGCCCCACAGAGCGAAACAGCTAGTTCT
CATTGCCTACAGATTTTGCAAGGTGGAAGTGCTGCAGGAAGCGAAGGTGGTGCGGAAGGAGCGACAAGTGGTGGAGGCGAAGCGGAAGTGCGTGCTTTCA
CAGGTGCATGTGGAGGTCAGGAGGTCACCATTGATGGCGACAGCTTTGTATGGAGGTTTCCTGTGCAGTCAAATTTCCAATGTCGTGTGGACCGCGTGCG
CAAAGGGCCTTATCTCAAGCTTGAAGCTCGAGATACACGACTGTCACTTGTGCGTGACAAGGGTTGGCAAACAGCAATTGGCGTGGCGCGTTTCGACGGT
GGGGTGCATATCTGGGAGGTACGGATAACCTTTGTGACTGCGAGCTCGAACATCTTTTTGGGCATTGCTCGCCGGGATGTCCGTTTGGACTCCTACCTTG
GAAAAGATAATCGAGGTTGGGGCTGGATTGGCAACCGTGCACTCTGGCACAACGGCAGTAAACAACGAGGGACGTACGGCGACAAATTCAAAACAGGAGA
TGTTGTCCGACTAACGCTGGACCTGCGGCGTGGCACACTGAGTTATGCTCTCAATGGGAAGGACTTGGGAGTCGCGTTTGGTCCGGGTGGAACTGGTCCC
AAACTCGAAGGCACATTCTACCCCGGGTTTGCTTTGTACAACCAACGTGACTCCCTTGATCTTATCGGCGGTCATCGTGTCGAAGATGGAGGACTTGAGC
CAGGTTTACCACGGACGGGCAGTGGACTGGCGAGTGGAGAGGACTCTTACTACAGTGAAGAAGAGGAAGATCTGGGAGGTTTTGTAGGTGGTGAAGGGAG
TATAGGTGACGGGTCTATCCCGAATTTCCGGATGGAGTTGGGCATCGCGCTAAGCCAAATGGGCTTCCCAATGGAGTGGTGTGTCTACGCTCTGCGTCAT
TGTGAAGATGATGCCGAACAGGCTGCTGACTTTATTTTAGCCAATATGCACGCTATGGAAGCACTCGTTCGGGAAGAAGCCGAGGCGATAGCGCGCCGTG
CACGCCACCGTCAGCTCTTGCATGAACAAGCACTAGCTTTGTCTGAGAATTTGGACGGTGACGTGTCAGACACGAGTGTAATCCCTCCTCCACCCCCTAT
TGAGAGAAATATCGATGCTCTTCGAGCTGCAGAAGAGGTGCCTGTTGTCGATACGATAGTTTTGCAACAACAGCAGCAACAATCGGCTGGAGACACCAAA
TGGGGTGTTGCTTTCACAGCCGTACCAGAATTTTCAGTTACAGGACGGCGTTTATTGGCGACCAAGTACAATTCTAAACTGCGCCGCCTGCATGCATCAC
AGCGGGTGTTTACTCCTGCGCACGATTGCGCTCTCGTGCAGCTCGTAAATGAGATTTGTGAATCACGAGCCGAGGCCCTTCTCAGCTGCGATCCTCTTCG
CATGGCACCGGAGGAATTTGCTCCCACGGAAGAGCAACTGCAAGGATTCCCCGTTCTGCGGAGCATATCTCGGGAAGCACTTCAACGCCGCTTTTTAGTG
CTGCGAAACTTCAACTGTCGTTTGCAGACCTCGCTTGCCTTCATAGACTTTTCGGCCCTGGGCGAACGCTCATTGTTGGCGCGTGGCGTGCGTGCACTTC
GTGGTGTGGTCTTTCAGCACGTGAAACTTGCATGGTGGCTTGGTGTTCTTAAAGAGCAGCAAGCACCAGCAGCAGCTCGTCCAGAAATTGAGGTTGACCG
CCATCGAGCTCACGACGCTCTTGAACTTTCAGAGCGTGGCGATCCCCTTGCTAGCGAAGCTGGCGAACGCGACAGTGTGTTTGCGCAGACGTTTGAGCAG
CTGCATGGCCTTCAACCTGCACTATTACGTGGGGCTGATCGCGCTTTCAAGTGTCAGTTTGTAGGCGAGTTTGGTGACGATTTTGGTGGTCTGTACCGGG
AATGCCTGGCTCAGTTGAGCTCTGAATTGCAGACCTTCTCACCTTTGCTTCCGGTGTTGCGACCGTGCCCCAACGCCCTGTTGAGTACAGGCGACAACCG
TGAGCTCTTTGTTCCGAACTCACATCTTCGCTCAAATCCACGCAGAGTGCAAATGGCCGAATTCCTCGGGAAACTTGCCGGTATTGCCGTACGTACCAAG
ACGCCGTTGGATCTTAACCTTCCACCTGTTGTATGGAAACTGTTGGTGGGACAACAGGTAACACGTCATGATATTGAAGCCATCCACCAAGGTTGTTTCC
AGGTGGTAGATACAATAGCTAATCTCGATGCCCACGGTATCACCGAGACCATGTTTGACGAGATAGTGGACGCAAGTTTCACGGTATTATCAAGCACTCG
TGAGACCGTAGAGCTAGTGCCAGGAGGGGCACACTTGCATGTTACGTGGGATGATCGCGAGGAGTATGCGTGTGCAGTGGAGACATATCGCCTGACCGAG
TTTGCACCGGTGTGCGCGGATATGTCGCGTGGTTTGGCAACTATTCTGCCCGCACCTACTCTACGTCTTTTCTCGTGGCACGAGCTGCGGACACTTGTGT
GCGGCAAAGCTTCGGTCGACATAGCTCTTCTACGACGACGGACCATTTACGGTGACGGTTGCCAGGCGACCGACCCGCATATTGCCTTCTTCTGGGACGT
TCTCGGCGAGTTCAGTGACGAGCAGAAGTCGTATTTCCTACGATTCGTCTGGTAAGGCATACACGTAATCATCCTTGCTATCTTAACATCGTCAAATAGA
TCTGACGAGCGGTAATTTGGTGTGTTTCAGGGGGCGATCACGTTTGCCGACGCACGCTGCAGACTTCACCCAGGACTTCAAAATATCCGGGTTGCCCAAG
GCGGCAGGTCGCGCCGATATGTACCTGCCGATTGCTCATACCTGTAAGCTTTTCATGTTTCGTTTTACACGAAATTTTCACAATCAGAACTGACAACGGG
TGTTTTCACAGGTTTCTTTTCCATCGACCTACCCGCCTACTCGTGCCGTGAAGTAATGCACGATAAGCTCGTGTATGCCATCACCCACTGCCAGTCTATT
GACGCAGACAACACGACTGTGGCCCAACGAGCTGGACAGGGAATTAACTGGATCAACGCTGCCGCCACAGCCACAGCTACTGCAACCGCCGCAGTCTCGA
GTGTTATAGCGGGTATGGCAACCATTGTTGGCGAGTGAGTGATCGTCTAAATTGACATAGGATTATCCATCTTGCACGTTCGATTGAATGAATTATCAAC
AAGAGTGATGTCGATGGCCTTTATTGACCTCCCGAACATTCCATCTAAGCCCCCTTAGTACGCACGATTCGTGGAGGTACCGCCCTCCTAAAAGCTCGAC
CCCAATCGCCATGATTGGCAACCTCATTCAGCGTGATGATAACAGAATCGAGATTCATGATGTGCGTTCGAACGCGCGTTCCGGATCGCGCGAAATGCTC
TTGAAGCGGGAGTCTGGCACTTCGAACTCCACGCTCAGTCGCCTTTGAAAGGGTCTGACCCTGTTAGCGCCCGCGAGGTAATCACGCGTTAGCAAAGTTC
GATTTGGGAAAAGATGCATAGGTAAGGGTAGCCACCAACCAACCTTGCGAACAGAGCGGTCGACGATGCCACCAACGACATATACGCAAGATGGATCAAG
GGTCTCGAGTACATTTTCGGAGTCTGGTGATAGGTAGACGATCTTGTCACTGTCATAAAGTTTTTCCAGCGGTTCGTCATGCCTTCCAATCTAGCCAGCA
GCCACCAGGTGAGAAACAAATACCCACCCTTGCAACAAGACGATAAGTGCCCGCACCTTCCAGCTAGACGCGCCATGCTGGGCACACACAGCATCGAGCT
CTTGCGTGCAGGATGCAAGATGCAGTGACACGAGGTTGTCCAGCGGACAGGTTTTTAGGTATCCGTACACACACCCGAGCTGCTTCAAAATGCTGTTGCG
TTCCTTCAAAACAAAACAAAAAACAACTGTAGTGTCAGCAACAATAGCATTTCCGCGGGCGAAACAAAACAATCATAAACACCCACACGGCTTGTCTGAT
CCACTGCAAACGCCAAGTCTACCACGACTCGAACACCATGCAACTTTGCTTCCTCGAGCTTTTGCTGCACACAGCACATCCGATCCATCCAGTCAGAGCC
GCAACTCAATCGTCACAGCAATTCCTACGGCGTCGTCTCACATATTGCTCCACCCGTTGCATGCGGATTCGCTCTCGCAGCTCGCCCTTCTGCTCCTCCG
TCATTTCGGCGCGTTCGGCAGCGAGCGTTTGACTTCGCGCGATCTTCTTGGCCTGCAGTCGCTGGTCCTTGCGGTCGCGGCGCTTGGCTCGCAGCATTTC
GCGTCGACATTGCTTGCTCGTCTTGTCACGTCGCCCAAAGCCTTCATCGCGCCGGCAATACACGTAAAGGCCCACCGCACAACACGCCGCGAAGGCCACG
AGTCCGACAGCCACAGCCGACGGTCTCATCTCAACCAAAATACCCATAAGTTGCCTTTTTCACAAGTCGCACGTATCCTTATTCCGTGATTGGCCACTCC
AAACTTAGTCCGGACGTTTCATTGGTGCAAAAGCTGCTGGTCCTCACGCCGTAGCGGCCACTGCCAATAGCTCAGTTAGCGATGGCGAACAAGAAGCGGC
GGCGCTCCGAGAGCTTCCAGGCCGAGCAGAGCGGCGCGGATGACGCCCGCAAGCGGCTGGCAGCGTTCCACGAGCGCATGTTCGAGCTGCCGCAGGAGGA
GGCGGCGGTGGCGGCCCCGGAGACGCCGCGCGTGACCTTCAAGGCCAAGAAGCACAAGAAGCACAAGAAGAGCAGGGGCCCGGGCGGAGACGAGGACGAC
GGGGAGCCTGTGCCAATGGTCAAGTTCAACGCGAAGCCGAAGAAGGCGAAGGCGAAGACGAAGGCGCCAGTGGCGGCTGCAATTGGGCAGGCGAAGAAGG
ACAAGAAGGTGATGGGCCCCGCAGTCGTCAAGGTGCCAGGGCTGTCCAGCGCAGTGAAGAGTGGAGCGCTGAAGACGAAAGTTGTCGCTCGGGTGGTGAA
GGAGGAGAAGAAAAAGACGCTGAAGCAGCAACACGCGACAGTGCAGACGGTGAAGAAGACGGCGAAGGTGCAGGTCGCGATTCAGGCGCCGCAGTGGCAT
TCCATGAAGAGTGGAGATGCCCAGGAGGACGATGATGGAGTGGACCCCTTGGAACAGGCGCTCGGGAGCATGAAGGAGCTCGTGACGAAGCAGGATGCCA
AGCCGCCTCGCAAAAAGCACAAGAGTGTGACGAGCAAAGCGGATGCTGCAATGGAGACGGAGAAACCAAAGGGTGTTGAGCCTACGGAGACGAAGGCTGT
CGAATCTGCTAAGGCTATCGACGAAACGATGAACGTGGATGTGAAACACGACCCGGGCAAGCAATCTACTCAAACTATgacgaagagtaaaaagaagaag
atgaagaaaaagagaaaACCGTTGCTAAAGCAGGCTGCATTGAAGGCCAACGACGATAAGGTTGCTCCACAAACACCGGTGGTAGTCTCGAAGCAACCCA
GCACCCCGTCCTCTGCAAGCAAAAAGGACACAGTTGGAGTTAAGTCGCCCATACCTGGTGGCGTGCATGGATCGGCAACTAATCAGCATACGGCACCATC
GCCAAAATCACCAGGCTCCCGCAAAAAGCGGAAAAAATCTCCCAAGGTAAATGGTATGAACCACGCATCACCGAAGAACATTGTTCCCGTGCAGCCAAGA
AAAGGAAAACCACTCGTTTTATCAGATGAACCGACGGGTGGAGGCGATAGCAACACGAAATCAGTGAAGAGCACCCACACGGCAGTGTCGAAGACGGCAA
AGATTGCGCCTGTACTGAAGGAGAACACCGAGGCTGCAGCACCGGCGTTGAAGACGCCAAAGATTGTGCCTGCACTGAAGGAGAACACCGAGGCTGCAGC
ACCAGCGTTGAAGACGCCAAAGATTGCGCCTGCACAGAAGGAGAACACCAAGGAGGCAGCACCAGCGTTGAAGACCAAGGAGGCAGCACCAGCGTTGAAG
ACGCCAAAGATTGCGCCTGCACAAAAGGAGAACACCAAGGCTGCAGCACCGGCGTTGAAGAACAATATCGCCAAAGTGGAGATGGCGGCTACGAAAGAAG
CGAAATTTACGAAGCCGTTGACGCCAATTGGAGCATCTCTCGCCAAAGACACAACTAAGAAGAATGACATGTTCCTGTCAGTTCGTGAAGTACCGGTTAA
GCCCACAGTGGCCCCCACACGCTTGGCAAAGGCGGCAGCGTCGCCAGTTCTTCAGATGTCAGAGGAATCGTCAGAAAGTGATGAAGAAAGTGATGTTGGT
TCCGATCACAGCGATGACGCATCGCTGTTTTCACGTCTTATTGACTCGGCAGCACGAGAACGTTGGGAACTCGTGGAGGTTGGACGTCTAGTTCGATTAT
TCGCGGCTGAGTGGGGTTTCAAAGAGGGCAAGACCGCGAGCTTTCTTCTTCACACATGCCCCGAACTTGTCAGTGTGGACTTCCTTGAAGGCCTGGGTAT
TAACTTGTCTGCGAAGCACCTGATGCAAGTTTTCGAGGCCGGGTCGGGCAAACCCGGAGTGCTAATGAACAAAATGGCGTCTGCATTAGAAAATGGACAT
CTGAGCGTGCATGACCCGTCATTTGTATCTGCATTGGAGCGTCGGGTGGCGTTAATGGACTCAAATGCGGAAGTGATGGAGCTGCTGCACCCGCTGATGG
AGAGTATGTCGACAGTGCGTGATGTCGGTTGCCTGTTGAAGCAATTGTGTGAGCACTGGCAACTAGAGCGTAAGATTGCTTTGGTTCAGCAAGTGTTGCT
GTCAAATATATTTGACGACCTAGACGGAAATCAAGATGACATCTTGCTCGACCTGCCTGATCTTACTGATCGATTAGATTTTCCGAGTCGGTTAGACCAG
GAAGATGTCGACGAGAATGGCAACTTGAAAGGCTTTCTTGCGAATGAAGATAGCGAATTTAGTGAAGTGGAAGGATCAGAAGACGAGCTGGATGAAGATG
ATAGCGAGGAGGAGGAGGAGGACCCTTACGAGGGTGAGACCGATTCGGAGGAAGAGACCGAAATTACTGGCCGTCCTCGGGGAAGGAATCAATTTATTGA
GGACGAGGCTGATGTTGGggaggaagacgaagaggaagaggagggggacgaagaggagCGCCAAGATGACGTTGAGTCGTCTTCATCAGATAGTGATTGA
TGAAATGCCACATACGCGGCTAATTCCAAATACA