Description :
From Genome Similarity Track
Location :
Scaffold_517:16730- 26666
Transcript NameFunction/comments
Phypl_g9079hypothetical protein PHYSODRAFT_359933
Phypl_g9080hypothetical protein
Phypl_g9081hypothetical protein
Phypl_g9082Multidrug/Oligosaccharidyl-lipid/Polysaccharide (MOP) Flippase Superfamily

Sequence
9936 bases(100 bases per row)
CTTctgcttgtcctcctcctgacTACCGCTGTCGTTCTCAGTCTTTTCTTCCccctcgtcttcctcctctactgtctcgtcctcgtccagctccacagGC
TCGTCCTCGCCAGCCTCTGCCTCATTGAGCGGGGCGTCGTCACCCTTCTGCTCCAGAGCAGCGAGCTCCTCAGCACGCATAGGCGGCGCGATGAACCACG
GCAGCTTGCCACGCTGGTAGTCGTTGATCATCTGCACGGCGACATTGTTGTAGTCGGGCTCACCCTTCGGGAGCAGCTTGCCACACTTGTTGGCGAGTTT
CTCGAGGAAGTCCCCCTCGTCATTCCACTCCTCGATGCCGTACACCTTGACAATAAACTCCTTCTTGACCCGCTGCAGGATGGTCAGAATGAAGTCCGTC
GGCTGAGGAAGACGCTCAGCACGAACGACACCCTTGAGCACGGTCTCAATCTCGTCGTCACCCGTGTCGTAGACGATACCGGGGCAATCAATCAGGAAGA
TGCGGCGCATGAGCGTAATGTACTGCCACACCTTGGTCTCACCCGGAATGGGAGCCACCTTGCACACCTTTTTCTTACGCAGCGCGTTGATAACCGAACT
CTTACCGACGTTCGGGTAGCCAATAAGTCCCACCGagatctgcttcttctcctggtgcagcttggcgaactggcgcagcaggttgaTCAGCGCACCCTTT
CCGAACGGGTTGCTCATGGACGCGTGGAACGCCAGCGTAGGCGTAGTCTCGCTGAGCTTCTGCACCCAGCGCTTGGTGACCCAGTTGGGCACCAAGTCGC
ACTTGTTGATGACAAAGATCAGGTGCTTGTGCGAGGCATTTTTGCGGatgtgcttctccacgtGATCACAGCGCGTGCCCGGCACGTTGCGGGCGTCCAG
AACCTGGATGACGACGTCCGAGcagtccagcaccttgtagAGCTCGCCCCAAATGCGCTTGGACTGGCCCTTGTTGAACACGTCGTGCGAGACCTCCACC
TTGAAGtcctgctccacgacgaTGTTGCGGTCCGGTCCCTTGGCCTCGTACTTCTCCGCATTATCTTGAGCTCgggagagcagcgacgcgtagTCGGTGG
CCGCGATCTTAGCGCGCTTGCGGCTGCGCTTGCCGTTGAAGACCTCGCCATAGCTCtcggtctccagcagcttcatgcgcgacgtcttctcgctctcctg
cagcaggcccATGGGCAACTTGCGCGTGCGCAGGACCACGGAGTACGGGTCGGCGGCCTTGAGGGACATCTCGTTGCggaacttgtccagctccttctgc
cCCACGACGCGCGTGTTGCCGAACCAGCGGCGGTCGGGCTGCACGCGGCcgctggcggtggtgatCTCCTGGCCACCGACCTTGTTCTTCATCATGAGGT
TGCCGCCCACGACCTTGCCGGCCTTGTTGCGGATGGGGCCGCTGTTGCGGTACATGTTGAGGCGCTTGATGGTGCTCTTGTCGCGCATGTTGGCCGCCTT
CTGCCGCTTGGGCATCTTGCGGTTCGGGTTATCGGCCGACGCCTTGGACGTGTTCAGGCCCTTCGCCATGGTGCTCGACTGGGTGCGGCGGGCAGGTAGA
TAGAAGATACTCacgcggcgatggcggcgacaaTTCCCCTTCCTTGCGCAAAATGACGGCCAAGTAGCTGTTCGCCTGGCCGCTGGGACGATTGGTTGGA
CGCGTCGACCGCGCACTTTTGACCAATGACAGGGTGCTCTTTCAACCAATCAGGTATTTCCGCCAGCCGCATACTGGTACGGTGTACCACTAGTGACAGC
GCCGCGTCAGGTGACGTTTCATCTATCTCTTTATTACATTCTGGCCCCGACAAATAGTGCTACTTTAAATGCTTCCTATCTATTGCAAACTACGCTAGCA
GACTCTCTATTGCAATTATAGCCTCGACAGACCAGATCAGGCAGCCTTCTTCATCAGACGCAGACTTCGACGACCATGGCGAGCatggcgctcgcggcgc
agcagcagcaggagcgcgccGAGATGGCCACGTACCTGTACGAGAAGCACCTGAACCACCAGGACGGCGTGGCCGGCACGCTGAGCATCCGACTGGTGGC
CGCCCGCCAcctgcgcgccgccgcctccatgtTCTGGGTGCGCACGTGCAACCCGTACGTGATCTTCCGCTTGGGCAAGCagagcgtgcgcagctccacc
atcCCCAGCAACGACAACCCAACGTGgcgccgcgagctcctcgaggtgaagctgcccAAGCTGGACCACAAGCGCCAGCCGCTAGGCGAGCACTCGGACG
TGCGGCTCGAGCTCACCGTGGACACCATGAACGAGGACTCGCTCACGGGCAAGGCCACGGAGGCCGTGGGTATGGCCAGCGGCTCGGTCATTGGCACGGC
CGTGGTCGACTTCACGCCGCTCATCGAGGGCAAGGAGGACGTCATGGACCAGTGGGTCCCGCTCAGCGGCGCGCTCCCCATGGCgggcgcagctggaggc
gctgcgacaggcaagaagcagcagccggtAGCGGATTTGAGCTTGGGCGAAGTgcgcgtcgtgctgcagtaTGAACCGCACGGCATGGAGCCGCGCGTCG
GCGACGTGGTCAAGTTCGAGGGCTTCGGCTCGTTcccgtcggcgctgctcggTCCCATGGAAGAATTGGAGCTGCACGTGAAGAAGACAAGTGGCAGCTA
CCTCCTGTGCAGCTACACGACGCAATCGGGCTATGAAGCTGCGCTGCGCGTGCACCGCAACAACGTGTTCGTGGCGCACCGCGGCAGCTTCTTTGACCGC
TTCTACGAGTCGTGTGTCGTCGAGCCACTGGAGTTCGTGGGCAGCACGCCTATTGGACAGTCCGCCAAGGAAATGCTGCGTCCGTATATGAACGTGGCTC
GTGCGTTCAGTGGCCCGGCCCTGGTTGCAACCAAGGCGACTCTCATGACGACGTATCGCGCGTCTACGGCGGCTATCGGCGCTGTGGTGGCGTCTTTGGA
CGAGTAGGACGACCGTGGCCTTGGGCCTATGTAGCTAGGAGATAGCCCGGCACAGTAATGAGTCAATGGTAAGTATGAGCCTGCGGACAAGTTGCAGTTG
ACTTCAGCCTCGGTAGTCGAAAATGATTGGCGAATAACGACGAAAcgcatgtagccatctcaGTCTCAGACTTGAAGCCATTCGCTGGTCGAGGACGTTG
ACCAGGTCCTTGGGACAATGCTGGGTGCAGCgcagcggagctgctgccgctgcttaTTCACACTGGAACCGCGCCCCAACCGGCGCTGAACGAGTCGCAC
CACGCGCGCGTTGCcgagatggcgtcgtcgccgccgtcccGAGCGAGTCTGGACAGCTTCCGGTCGCCCGCAGACAAGAAGAGCTACCGCCTCGTCACGC
TGCCCAACGGACTGGAAGTTCAGCTTGTGCGAAGCGACGCTGGACCCGGAAGCCAATCACCGGGCGATTGCAACGATGATCGAGATAGTCTCAGCTCAAC
GGACGACACGGACTTCGACAGTGCGGAGGAAGGGGGAGGCGAGAGCGAAGAAGAGAGCAACGACCGAGCTCCCCCGTTGGCAGCTGCGTGTCTGGCTGTG
GACGTCGGCAGTCTGGCAGACCCGGAAGGGCTACCAGGCCTGGCGCACTATTTGGAGCACATGGTCTTCATGGGCAGTGCGAAATACCCGGCGGAGGACG
CGTTTGAAGCTTTCCTCAGTGCGCACGGCGGCTCCAGCAACGGAGCGACCGAGTGCGAGTCCACGCGCTTTGTATTTGATGTAGATGCCGCTTACTTGGC
ACCTGCACTTGATATGTTTGCGAGCCTTTTTGTGGCCCCGCTATTGCGAAGTGAAGCGATGGACCGCGAGCTGAAAGCGGTGGAATCGGAATTCCAGCGA
GTGCGAAACAACAACCCGgtgaggctgcagcaggtgatGTGCGAGACGAGTGTTCAAGGCCACCCGTACTCGCGCTGCTTTACCTGGGGCAACGCGGAGA
GCTTGAAGCACCGCCCAGAGCGTGATGGAGTGGATGTACGTGAGCAGATGCTGGAGTTTTTGAAGAAGCACTACGTGGCACCAGCCATGAAATTGTGTGT
GTACGGATGCGAATCGCTCGATAAGTTGGAGCAGTACGTGACCCAGAGCTTCAGCGATATTCCACGCTGTCGAAATGACTACGATGTGCCCAGGTCTGAG
AAACTGACGGTGCCGTACGGTGGTGGGGCAGGTCAGCGACCAACGGTCTTACGCGTCATTCCAGTAGGCGAGAAGCGTTCCTTACGATTGTACTGGATGC
TTCCAGCAATGATGGAGAACTATCGACAGAAGCCTTGGTATTATGTGGCCCACTTGCTGGGACACGAAGGTCCAGAGTCTACGGCATCAACGCTCAAACG
CAGGAAGTGGGCTACCGATGTCATTGCCGGCACCTCCGATCGAGATGGCTACGAATTCGGGTCCTTTGGTACAGTTTTCGAGGTCCGGGTGTCTCTCACC
GAGCGAGGTCTGGCGTATTGGGAGCAGGTTGCTCAAGTCGTTTTCGATGCTCTTCGCATATTTTCAGCTATGGCGGCAATTGGAGATTTACCTGCGTGGG
TGTTTGAAGAGCTCCGCTCGTCTAGCGAGATGGACTTTCGTTTCCAAGAAGATGACAAAGCACCCGTGGCGCTATGCCAAGAACTCAGTGAACGGATGCT
GCCACGCCACAATATTCAACAAACTTGCGATGGAGACCTACTACGCTACGATCTGATCCAAGGAGAATTCGATACTTCGCTTTTACGTGCTCTGCTTGGT
GCTCTCTCTGCCGATAGAGTTCGTGTCGTGCTGATGGCGTCTTCATTTGCCGAAACCTTCGACTCACAAGTCCAGACCGAACGGTGGTTTGGCACCAAGT
ATACTGTAAATCATATCCCAGCTACGGTGATTGCGGCGTGGTCCCGGACCTCGGAGGAGTCCATAGAGCTATCACCACTGCCAACGCCAAATCCGTTCAT
GCCTCGGGACTTCTCATTATTGCCTTACGAGCCGGCTGTTCAAGGTGATAGTGACGTTCCTCCAGACCTCATTCTcacaacttcaacaacgCAGCTTTGG
TACAAGCGCGACCGCACGTTTTTGGTGCCCAAGGCGAGCGTCAGTTTCCTCGTGACGCTACCGGCTccaacgccagcgacgcATATGCTCGCTGAGTTGC
ATGTAGAATTGGTGCGACACCGCTTGCAGCATACGCTGGAGCAAGCTGACACTGCAAGCTTCGATACCGAGTTGGATGTCCGAGACGAAGCTATTGAGGT
GGTGATCTCCGGGTTCAGCGACACATTGCCAGCGCTCGTTCATACCGTCATGCGAGAGGTTTTGTGTCCGTCAAAGGCATCGGAGATTGCATCGGAGTTA
ACACTAGCGCGAAGCGAACTCGAACGCGAGTACCGCAACGCTACACTTTCTCCCCGAGCAAAAGCGTATGAGCTACGTCTACAAATGCTTGAAAGCAGAG
CCGTCACCACAGATGACAAGCTGGAGGCACTCCAAAGCCAGTACGGTCGTGAGAACGAGCTCGCAGAAGATCTGGCACGCTTCACGACAGCGGTCCTTGG
TTGTGCTCAAGATATACCGGTGATACGATGCCTGGTCCTTGGTAATGTGAGCCGGGAAGCTGCTGTTTCACTCGTGCTAGATGTTGAAGCTATCAAAACC
GGAGATTCGGCTACTGAGCTACCTTGTGAACCAGAACTAGAGCTTGAGCCAGAGCCCCCGATACTGGCTCCAAGATGCCACACGATTGCGCTACCGCCGA
CAGCCAACGGGCTACTGGTACGTCGTCAAAGTGAACGTGTCGGGGAGCGGAATTCCGTGGTGGAGGTGTATTTCCAGATTGGCAAAGTTGGACCAGTAGA
TCGAGCGTACGCAGTCTTGCTGCGCACTCTGCTGGCCCAACCACTCTTTCACGAGTTGCGAACTCGACAGCAACTGGGATACACAGTGGCTTGTAGTATT
CGAGATACGCATGGCGTACTCGGACTGAGTGTGAGTGTGCAGTCTGCGTCGCATGCTACTGGGGcggtggcggagaagctcgaTGTCTTCTTACACGAAG
ATTTCCCGCATGAATTCCTGCTCTCAGAGAAGCGACTTTCGCCCAAACGCTTCGCAGCCCACGTGCAGACTCTGCAGCGAGCTTATGCCCGACCTGACTC
AGCGTTAACCGAGCAAAGCGAGCGATACTGGGAAGAGATTGTAAGTGGGCGCCTGGAGTTTAACTTGGATGTGCGGGTAGCGAATGCGCTAGGAGAATGC
ACACGCCATGGGCTGTTCTCAAGGTACCAATGCTGGTTACAAGGAAGTACTAGCTGCTGTAGTGCATGCTCTGACAACCCGCACGAAAATCGCAATGCTC
ACCACGGAGCGAGCAAAGGCCATGGCCCGCGGAAGCTTCGGGTGCATGTTGTAGGCAAATGCAGCCCGTTCAAACCACTTGAGCAGCTAATTCCACCTGA
GAAGACCCCCGTGATCATCACAGGCGACCTGGACGATTTCAAACGAGAGCTGCAATGCCACTGCCACGTTGATAGATAGTAGATAGACGGGGGATGTGAC
CTAAGGGAGGAATCTATTGGGACTGTTTTGTTGCCTAGTGCAATTGAGATGACTGGCGCACGGATATCTACATACGATGGGTCTAGCACCTTTGCGCCTG
TCAACCTTCGCCCTGCACCTCGTTAGGATGTTGGTACTCGAGTAACTCTGACGGGGATACAAAGTTGTGTATAGATGGCCGATGTAAGGATGCAATGTTG
CTGACACGCCGAAGTCGAGGTGTTGCAGCTGTACTACCAGCAGCCGGACCATCATCACTTGACTTTGATCCACGCAGAAGTAGGTTCCGTGAGGAACCCC
GCGTCTTCGACATTTCGTGCAGTGCGTCGGACACTACGAGGCGCTTCTCAAGGTTCATTAGTCGGCTTTCGATGCTCTCAGACTGTGACTGCGCCCGTGC
TTTCATGGCCTCCACTTCGTCGGATACTCGCGATACTTGCTCCAGAAGGCTCTGAAGTGTCAAGTCCAGCACTAGCGCCCAGGTTGGAACAGTTTCTTGT
GAGGACGAAGTGACCTGGGTAGTAGTagccccagcgccgagaaTGCTAGTCGCCTCGTTGACTACGGAATGGAGCGGACTACTGCCATTTTCTTGCAAGG
TGGACATCGTTGGTGTCTGCTGTCGAGGTTGATAAGATTGCTGCGATATTGAACCTCCTCTGTTTGAAGGTGCAATCTCCACAGGTTGCTCTGAgatggc
agcggcagccagGATGGTGCTTAGCTTGCGCGTGCTTCGCGAGCGACCCGCGGTTTGGGCCAGGAGAAGCTCCGATAGCTCCTCGATTTTGGTACGAATG
TACTCGACATTAACCTCCATCATTTCCAGCATGGTCATCTGCGAATCCATGGGGTCGCTTACATCATGCGAATGCACTCGTCGCTTCACTTGGCGATACT
TTCCCAGCACCGTGAACAATTTCAGCTCTGCTCGACGCAGAGCTCgtttggtgctgctggttccTGTCGCTTTGCCTTtgttctcggccagcacctcggt
TGTTGTGACACTGACAGAGCCGCTTTCGCCTACGTCTGGACCGGATGGGCCCGATTGGTGATGTCGACGCTGTGCCGCGCGAAGCTGTACGAACGCCTGT
AATGCTCGAGCTGCATGGTCATTTATCAGTCTTCGGTTTTCGTCTTTCTTGAGAAAAGCATTAACCTTGTGCTCCGAGCGCGTGAGCACGAGGTAGTTGC
TCATGACTGCGATGGTTACTGCAGTGGAGAGGGTGCCGAAGATGCCAGCACCCACTGCAATTGCACGGCCTAACGTAGTTCGTGGGACGACATCGCCGTA
GCCGATGGTGAGAATGGTGATGACGAGCATCCAAATTGCGTCGCCGAGTAGCATGGGCTCGCAACAGGAGTCTCCTTTGAAGGCGCATAGGAAGCGCTCG
GTCACATACAACGCGTACCCGGCGACGCACCCAAGCGTGACAAAACTCGCCAGGAGACACCTGGTGGGGTAGTTCTTCAGCGTTGATTTCATGAAGAAAG
TCGCGGTGAAGTCGACATTGGTCAGCGCTCCAATGAACCATCCGTTGCTCGAGTTGAACGAGTTGCGgaactgcaccacgcgcaccacAAGAGCCACGCG
CGTGAACATGAGGAGACTGGTAGCCACCGTCAGCTGTGGCCATTTCGGATCTACGTCTTCAATCCCAGGAAACGGATGCACACCAAGCACGGCCATTTCA
ACGAGCAGCGTGTGCCGCAACGAAGACCTGAGCAATGTAGCCTTCGGCGGCATGATGTTCTTGAGCTTCATGACTTCGCATTCCGCCGCGTAATACTGGT
AAACGTAGTACAGCATGAGTGCTGTGGAGAAAGTAATGAGCACTCGCAGCGCCAAAAGAATCATACGGCCTTCGCTCACTGGCACCGACGTGCCTAACGC
CTCGAAACAAAGCGGGCATTGTGTTGACGATTCCACCGGGCACGTGTCGGGCAACGTCTGCGTGTTGGCGAACCACAAATAttccagctgcaccatcaTG
AGCACGATACCGAAAAACCCGTAGAAGAGCTGGAAGGCCGTGTgccgtcgctgagctcgtacGAGCATcatgcgctgctcgtgtacTGACACCATTTCCG
CGCTGGTAGCTTTGGCCTTGCTGCCGAATGTGTTCACTTTGCTGGGCTTCTGCGGTACATGCACAGGTAAAATCACTGCTTCTGGGCCGGGACGTGTGTC
TGCTTCAGAAGTCTCGGTACCAGCCATGgcagcgtccagcggcaCAATTTCGTTCCTGCTCGGCATGGTCGCTGGCTATGACACAAACTCACTGGAAAAA
CGGAGGCACCGGAGGTCGGCGACGCACAATTCGACGGCCAGGACGCGCGGGCATTCACGCGCGCTCGGCTGCAGGACAATGGAGACGGCCGCGGAGCAGC
CAGCAGGTTCCGACCGACGCGGCCAAGTATCAACAGCGCTTGAAGTTGTTTCTCTCCACTTTACCGTAGTGCCGAACTCCATGCACTGCAGTCGCGTATT
AATAGGGGGACGGCTCAAGCGGCGGTCAGTTTCTCTTTTCGCACATGACCAagcaggcaggcaggcaggGAACTCTGAGCTCTGCAAATAGGCGACTTGG
TCCATTGCAGAtcaactcgtccagcagcagcatcagcaacagcagcagcctcctaGTCAGTCAACAAGAATGGTAGTACACAGCACCACAGCACGTGAAC
GCAAGACACAACAACGCAGGACGTAACGCAAAGAAGCTGCTTATTTAATTAGCCAGGTCTCCTCTACGTGGTTCAATCCACTCAAATCCTCTCCTTCCTC
CCGGCACGACCCAAGGTCGCACTAGTTGGCTAGAGTCATGGTTTTGGTCCGCTCTACACGACGCGTTCGCCTAGTAGAAGAAGCCGATGATCTTGCCACC
CGTGTGTTTGCGGCGGGCCTCGTGGTGGTCCATGATGCCGTACGTGGTGCTGACCACGATGTGGCCGAACTGGCGCGAGGGCAGCAGGTTGTTGATCCAC
TTCTCGTAGTCGGCCATCTTGACGTCGAAGCGGGGCGAGATGACGCCGCACTTGTTGATGCGGcccttgagctccacgacgatCTTGCCGGCGCGGTggt
cgtccacgatctcgaactcgccgaTGTAGCCGTTCTTCTGCATCAcctgcaggaacttgacgaTCACCTTGGAGCTCGGGCGGATGAGCACCTGGCGCTT
GCCGCGCTTCTCAGCGTTGAACATCGTCTTGAGGcagtcggccagcacgctcaTACGAACCATGGCTGAGGGGGACACACGACAGACACACAACGCATTA
ATGCCTACTGCTAGCAGCCAAGGTcagccgccgcct