Description :
From Genome Similarity Track
Location :
Scaffold_5:167299- 169950
Sequence
2651 bases(100 bases per row)
GGCTTAAGCAAGCCAACGTAAAACACTGGGTCTGTGCGCAGTATGCGCGGGAGATTGAGTGTACAGGCAAGGCCTTTCTTCGCGATGACCGTAAACGGCC
CAATGAAGCGCGGACGCAATTTCGTCTTGAAGACGGCAGACACTACATTTGTAGGTAGGTTTTAGCATTTAATAAGACTTGGTCTCCAACTTCATAAGAA
TCAATACATCCTCTGCCTTTAGCATCAGCTTGTTTTTTTTGTTTATCTTGGCTATCAGCCATTGCATCACGCACTTGTCGTAAGACACTAAAGCGCGTCG
CGAGAAAATCGCTCACTTGTTTCTGCATCGTGGTAGGGCTGATGTCAGCAAGCTTGTCAGCAGACTCTCCCCCACCAAGCCCAGAACCACGGAGTGGTAA
CGTGAGTGGAACGCGGGGTGCGTGAGACTATTCACATAGAAGGGAGTAAAGTCGGTCGAGGCATGAACAACGTCGTTCAACGCAAAATCAATGACAGGGA
GCATCGAGCTCCAAGTCTTAGGCGACTCAGCACAAAAACTGCGAAGAACGTCGCCAATGACGCGACTAACTCGCTCAGTATGACCATCGCTGTGGACATG
TCCAATCGCGTGCCAAGCAGCTTCACAGGCAAGTCCAAAACTTGCCTGTGAAGCGAGGGGCGCAATCAGAGATGATTGACAGCGGCAACATTTGTTGACG
AAACACACGATCGATAAACAGCATGGCTGAACCTTTGCCATTGATGGAATCCGGCACCGCCGCCAAGTGAGCCATCTTGCTTAGACAGTCAACAAAGACC
ACAATACCCGTATTTCCGTCACAGTATTTGGGAAGACCGAGCACAAAAGCCATACTGATGGACTCCCAACACCCCGTGGGCACAGGTAAACTGGCGAGTG
GCGCAGCCGAATGTGCTGAGGGTTTGACCCGCTGGCACGTTTCGCATGTATGCACGTATGTGCTCACCCATTTGTAGAGTTTGGGCCACCAGTAGTGTTG
AGCCACAGAGCCAGAAGTCTTTTCCTGGCCCAAATGCCCACCGAGGGCAGTATCGTGGGACTCAAAGAGGATTTGATGCTTTAAATCCTCATCATGAGGT
ACAACAATGCTAGCGGTATCCGCTACATCTGTGCCATAGCACAAGAGATCATTATCGATGTAGGCTGTCCCACAAGCGTGCCGATAATTGACTGTCCAAG
TCCTTGTATCCCTCATTTCCAAGGGCATGAAACAATGCCACACATTGAAAATCCCGTGGATATGCCACACGAATTAACTCCTCAATAGGAGGCGACAAAG
TCATGACATGAGCAAGCTCATAATCAGGTCTGCGAGAGAGGGCATCTGTCAACGCATTCTGTTGCCTGGCTTATACTTCACCTCGAAGTTATATTCCTCA
AAGAAGGAAAGCCACCGAGCCATTCTCTGAGAGATGTGAGGCGACTGTGTCGCCGTGCGCAATGACGCATGATCCGTAAAGACGACGAATGGCTTGGAGC
CAAGTAGATGGACTCTAAATTTGACGAGCGCATACTTCATAGCAAGTATCGCTTTGTCATGAACGGGATAGTTCTTTTCAGCAGCTTTCAGCTGACGAGA
TTCAAATGCGATAACTCGCTCGCAGCCTGCAGCATCTGTTTGTGACAGGGCGCTGCCTATAGAAAAATTTGGTGCATCGCAGACAACACTAAAAGGGTAC
TCAGGATTTGGCAACGCAAAAATAGGAGCATGGAGGAGACTCCCCTTTACTGCCCGAAATGCGTAAGCATCGGTGTTGTCCCAGCGACAATTTGTGTCCT
TCTTAAGGAGATCAGTTAATGGCCGAGTCATATCAGCATGATTTTCACTGTATTTGTGTAAGTAATTGGCAAGGCCAAGCCACTTACGCAAGTCTTTTTG
ATTCTTAGGAATCGGCCAGTCCACTATAGCCTTGACATTAGCGGAATCCGCTCTAAAGCCGCGCTTATCAATGAAACAGCCCCAACATGGGATCTACTCT
GCACCAAAAATGCATTTAGACGCGTTGGCGTAAAATTTGTTAGTGCGCATGCACTCGAGCACGGCTCGCAAATGATCGATGTTGTTGTCAGCTTCTGACC
GACCTTGTTCGGCACGACTATGGACAAAAATTTCATCAAAGTACGCCTGGGAGTAATCCCGATGTGGGCGGAAACGTTGCGTCACAGACGGTTAAATGTT
GCCGGAGCATCAGACAGCCCTTGGGGTATCACCAGCCAAATCCATAACATACCATCGGAGTGCTCACTGCTTTAACCGGAATATCACTCACTCGCATGAG
CAATTGACAATATTCATCGACCAAGTCGAGTGAGATATACATATTACAACCAACCATGCTGTTTCGAAGAATATCCTTTCGAGGAATGGGTGTCTGTGTC
GGAATAGTAGCCGCATTAAGCTTGTTATAAGCATGCACAATACACCACTTGTCGTTCGGCTTTTTAACACAAAATGTCGGTGTCGAATGTGGAGATTTAC
TCTCACGTACCATTACTGCCTCGTGCTTAGCACGGAAAAAGTCATCAATGACATCACATTGCTCCTTAGGCAAGGGTCACACAGTATGTGACACAGTATT
CAGTCCCAGGAACTAAGTCAATTTCATGACGGACACCTCTATCTGGAAGTA