Description :
From Genome Similarity Track
Location :
Scaffold_563:16729- 18527
Transcript NameFunction/comments
Phypl_g9423hypothetical protein PHYSODRAFT_245876

Sequence
1798 bases(100 bases per row)
GTGACTGGTACAAAAACCGTGATCCAATCAGGCAAGCATCGAGTGAGCAGCTAAGGCTgcgcggtgctggcgctcgccttcgcctcGGTGAGATCGAGGA
CATGCTGTTCGACGAGATCATCTACATGCGGTCCCAACATCACAAGGTTTCGCGGCAATGGATTCAAGCTGCAACCATTCATCATGCACGCAgcgtgctg
aacgacgacagcttTGGTGCCTCTGAGCGCTGGCTTGGGGCATTTATGCGCTGTTATGGACTTTCGCTCAGGCGTACCACCAACCTGACCACGCTTACGG
ACGAGGAACTCGTTCGCCGTGCCGTCGGTTTCAGGAGCTACCTCGGCAAGCTGAAACCGGACATGGATTTGGCCCGCACCGTTCTCATGAATGAAACCGC
AGTATACTTCGAGGACCCCCGCCCCCGCCGCGAAACAGTAGACTTCGTGGGTTCCCGTCATGTGGTGCTGCGGTCTACTGGTTTTGCGTCGATGAGAGTG
ACTGCAGTGCTCGCTGTAACAGCCGATGGCACAAAACTTCCACCTCTTGTCATCTGGAAGAACGGTTCTACCGGGACTACTGGTATGAGCAGTTCGATGT
TCGAGAAGTTGGACGGCGTGTATGTGGTTACGCAAAAACGCGCTTGGGTAGACAGCCCCCTGCTTCAACGATGGCTGGATCTCGTTTTCCTGGTGCTCAT
GGACCACTTGCCTGGAAAGGCACTCGTGTGGGAAAGTATGAGCGCCCACATCTCGAAGGTGGTCAAGGCGAGATGTGGGGCAACGAAGGTTGACATGGTT
GTGGTGCCTGGTGGTTGCACACCGTACATTCAGGAGGGGATATTGGGATTTATAAGTCTTTCAAAGACCGTATGGATCCTCTCGTTAACGAGTGGAAAAC
ATCGGCTCGCGTGCAGTACACGCGTGGCGGCAACCCGCGGCCACCTTCAGCGCGTGAGGTCGCTGGGTGGGTCAAGCAAGCTTGGCTCAGTGTACCACCT
GAAGTGGTTGTCAAGTCGATTGGCGGTGCAGGCTTCTACAACGACTACGAAGAATGGCATGTAGCGAAGCACGACGTCTACGGCGATGCATTTCGCGCGG
AATGTAACAGTTGTATGGATGGGTTCGGCGCTGAGGAAGAACCACCGAATGACGCCGAAGTGGTGGCCGATGGTGACGGCGAGCATGTTTGCGAACTTTA
GTACCCTCCTAATACAACACCCTCCATTTTGAACATCAATGTGAGGTGGTATACTAATGCTATAATACCGGTACACTAATCGGAAGAACCTGTTATTCCG
GAACGGTTTATTACTCAACTCGCGACGATTGGAACAATGACGCGTGTGATGAGAGGCGAATGTCACCGGTGTGTTCGCACACGTTATGGAATTAGGATTC
ATCAAAATGCGGGTGGTGATGGAAATGAATCCGACAACTGTCAGGCTCAAGGTGATGACGACAGTTGAGAACGCCGGATGACGTCGATGGAATCAGCGGC
GTTGCGAGATGGGAGTTGGGGTGCAGAATCAGGGGTTGAACTCGGCCCGGAGACAAACTAGTGTGTGCCACCCCACGTGGATCCTAAGTTAGGNCCAAGG
CTAACATAAATCAGAGTCGAATTTGCTTGGAAGTGCGCAGTTGGTTATTGGTATGGTATTGGTATTGGCCCATACTTTAATCTAGTAATCTACGCCTTAC
ACACGTGGCAGCCCGTTAGATAGCTTGGCTAGTGATTCCTGTCCTtcgaccccccccctcaaGACCCCGCTATtggaagcggcaagcaacGTAAAGGA