Description :
From Genome Similarity Track
Location :
Scaffold_69:167269- 169604
Transcript NameFunction/comments
Physo_139028pol protein

Sequence
2335 bases(100 bases per row)
CTGACGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCAAACGCCCCGG
CAACATTCAATCGCCTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCGCGCAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGG
CCTTTCGGTCATGGAGATGCATCTCCAGCACCTCCGTCGGGTGTTCAAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGCGTGTTTGCA
GCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGAGGTCCACGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGT
CGCAGAAGGACCTACGACAGTGGCTGGGCCTTGCCAACTATTTGCACAAGTACAGTGCAAGCTACGCCGAGCTGGCACGACCATTGTCGGATCTCTTGAA
GAAGGATGCCGACTGGCGCTGGGAGCACCGCCACCAAGGTGCTTTTGACGACATCAAAGCGTGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAG
ACGAAGCCTTTCAGCGTCGTCTGACTACGTAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCGGTCCAGGCAG
CTCAAGGCTGCCGAACGGAACTACCCAGTTCATGACAAGGAGCTACTTGCAATGAAGTACGCTCTTGTCAAGTTCCGAGTACATCTCCTGGGCTCGAAGC
CCTTTGTCGTCTATACAAACCATGCGTCCTTGCGAACTGCCGTCAACACGCCGCACCTCTCGCAGCGGCTGGCGCGCTGGCTGTCATTCTTTGCGGAATA
CAACTTCCGTGTCGAGTACAAGCCGGGCAACCTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACG
ACGGATCTGTATGATCGCATCAGGCTGGGATACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGCCGCCAAGGTCGAGT
GGCTCACGCCCCGACAGCGTGCACGGCTGCACCGCTTTGAGTGGGCTGACGGCTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTTCTCGTATTGTCGT
GTCCAACGACGAGGGTCTCAAGTACGACATCCTGATGTAGGCGCACGACGCTCCATCCAGTGGTCATCTTGGCCGTGAGAAGCCGTACGCGTCTGTCTCG
CAGACGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGGACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCAC
CATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGCCTCCCGTCCGATGCCCGTGGCAACACCGGTGTTGT
TGCCTTTGCCGTATGAGCAAGATGGTACACTTTGCTCCAGTTCGTGACACCGTCACTGGTGACGATGTCGCTCGCCTGTTCATGGACTGTGTCTTCCTGC
ACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTGCGTTCTGGCAGACGCTGTTTCGCCTTCAAGGCACACGGCGGTCGAT
GTCGACGGCGGACCACCCGCAGACGGACGGCCAGACGGAGCGAGTCAATCGCGTGCTCGAGGACACGCTCCGCAGTATCTGCGTGGAGATGCCCCGCTCT
TGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCGTTACGCCCTCTTACCTGAACGGGTTGTGCCACCCTC
AGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGGCCTAAGTGGGGGAGAGGCTAGGAAAACCTTTTCCTCCCAAGACTCGGACGCGAGTCCAGC
CGCCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAACAGGGTGCGAGACACCATGGCGCAAGCCCAAGACAAACAGAAGGAG
TACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCGACCCCTAAACACTGTTAGCTCGG
TCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCTAAGTCGATGACGAG
TCACCCGACGTTTTACGTGGGTCGTCTTAACCCCT