Description :
From Genome Similarity Track
Location :
Scaffold_81:167269- 169170
Sequence
1901 bases(100 bases per row)
TCGCGTGGAAGGCCAAACATAAAGTCCATACTGATGGACGACCAAAGTTCGTCGGGTGTCGGGAGAGGTTGGAGCGGCGCTTTGGTGGCCGCGGTGATCT
TGGTGCGTTGACATGCGTCGCATCGAGCGACGTAGTGAACCACGGATTTGTAGAGGCGCGGCCACCAGTATGAACGCGCGACCGCGTGGAACATCTTGTC
GCGGCCGAAATGGCCACCGCTGGGGGAGTCGTGGAAGGACCGGAGAATAGCGGCGCGTAATGGCGCGTCGCTTGGTACGACGATGCGAGGTTCGTCGCCG
TGGGAAGGGGTGAAATACAGGAGACCATCGCGGATGAAATAGCGATGGAGTAGTGACAGGGAACGGCTTGGCTTTGAAGAAGCAGGCGCTGTTAATGCTG
ACAAAAGCGCAGAACACGTGGGGTCCGAGGCGTAAACCGCGCGGATGCGGTTTTGGAGTTCGGAATGAAGAAACCCGATCGTGTTAAGGGCGAGGTCGGG
ACGCCGAGAGAGGGCGTCGGCAAGGATGTTGTCCTTGCCCAGTTTGTATTGGACGGTGAAGGTGAATTCAGCAAAGAACGAAAGCCATCGTTCCATTCGC
TGCGAGAGGTGCGGCGAGTTGGTCGCCGTGCGGAGTGAGGCGTGATCTGTATAGATCACGAAGGGCTTGCTACCAAGGAGGTAGATGCGGAATTTGGTGA
GGGCGTACTTCATCGACAGAAGTTCGAGGTCGTGAACGGGGTATGCGCGTTCCGCCGGAAGGAGTTGGCGGCTTTGATACGACACGGGACGAGCGCGCCC
GTCCGCGTCGGCCTGCATCAGACTACATCCAATTGCGAATTTGGATGCGTCGCACACAACCGAAAATGGACGCCCGAAGTCAGGAAGTGCCAGAATGGGC
GCACGTTGTAGGCTGGTCTTGAGGGCGTCGAAGGAGGATTGGCAGAGTCCTCCCACACCCAAGGAGCGTCTTTGACCAAAAGACGAAACAACGGTTGAGC
GAGGTCGGCGAAGTTCGCCGAGTATTTGGGTAGGTGGCGAGTCCTAACCACCGCCGGAGGTCGTTGACGGAGGATGGGGTGGGCCAGTCCACAATGGCCT
GAATCTTGTCGGGATCAGCCCGACAGCCGCGTACACCCACCAAGTCACCGAGAACAGGGATTTCGTCGACGCCAAAGAGACATTTGGCGAGGTTGGCATA
AAGGCCGTTAGCACGGAGGACTTCGAAAACCGCGCGGAGGTGACCGCGGTGTACGTCGGCGACCGAAGAGGTTGCCGATGCGCGACTGTGGATGTAGATA
TCATCGAAATATGAGGGGGCGAAGTCGCGCAGGGCGCGGAACTTCGCGGTCACCATGCGGTTGAACGTGGCGGGGGCGTTGGAAAGCCCCTGTGGCATCA
CCAACCACTCCCAGAGCATGCCACTGGGGGTTGAAACCGCTGTCTTGGGCACATCGTCCAAACGCATCAGGATTTGATAGAAACCATCGCGCAAGTCGAT
GGTAGAAAAGATGCTGGAACGGCCCTGCCGTCAATGATGACATCTTTGCGGGGGATGGGTGTTTGAGCCGGGATGGTGGCGGTGTTCAGCTTGTTGAAGG
CATGAACAATACGCCACTTGCCGTTGGGTTTCTTGACACAGAACGTAGGACTACTGTGCGGCGAAATACTTTCGCGGACATGTCCGGCGGCTTTGCGCGC
CGCAAAGAACGCGTCGATAGATTCCACTTGCTCGCGGGGAAGCGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGCAGGAGATCAATCTCGTGTTGT
ACGCCTTTGTCAACAGGGAGGCGACTAGGAACTTCGTCGGGGAAGACGTCCGCAAACTCGCGGAGGAGGTCGAAATATGGGTTCGTACGGAGGGAATCCC
A