Description :
From Genome Similarity Track
Location :
scaffold_553:16720- 20336
Transcript NameFunction/comments
Pl_103885conserved hypothetical protein

Sequence
3616 bases(100 bases per row)
TTTCCAGCGGAAACGCGACTAGGGAAAAGGGCAACTGAGCCACACCTAGCCACCCACACCCCCGCATTCACTCCTTCCGCTTCAAGTTCAATTCCGCATT
CTTGGGAATGCTCGAGTTCCCCCTACATGATGGTTTCTTCCCGCAGATCGCGCTAAGTCGAGAGGAAGTGAAGTACTACAAGCGACTGGGGAAGGAGCGT
GTGACGCAGCTTATCCGCATCATTGAAGACGCCGATTGCGCCTACAAATGGACCAACAGCGACTCCGCCACACACCGCAGCGCTCGGTCGCGTCTTCCAG
GCCGAAGTCGCCTCAGTCTCGAGTCCAAGGACGACGTGTCTGTGTCGTGTCAACGTGCGAACTTTTTGGACTTTCAACCCGCTAATAAGTCCACACATGC
GTCTACGTTACTTAAAGCTAGTGTCCAATTGACGGACACAAAAGTAGACGAGATTCTACGCGCGATTGCTAAAGTCAAGACCAAAGATCTCCGGAAAGCG
ATGCGATATATGCATGGAGATGCATTTGTGGATGGCAGGACGTTGTTTACTTTTCCACAACAAGCTACAAGATCTGGCAGTGATGTGACAGAGAGAACAC
CGTCGAGAGCGTCGTATTCGTATCGTGCTATCAAGTGGCATGCTTTTAAGACACAACGACCACGACATGGAGAAGATGAAAAGATTTTGGATTTCTGCTA
CTTGGAATATGCAGGGAAGAAAAAGCCACATCCTGGCTCCAACGTTGTGGGCTTTTGTGTTCAAGAATCCATTTCTAGAGATCGAGAAGTACCGACTTTG
GAGAATTTCGGTATTGCAAGAGGATATTTGTCGAGAATGGGCGTTATTGTCTCCAAGACACACCAGCCGAACACATTCAAAGTGACCTCGATCTGTCAGA
TTGACGGGGATTTGAATCCTATTGTAAGGGGAGTGCTCGAGGAATTAATGAAGAAAACGGTGTGTGCTGTGGCAAAGATCCCAGGACTTGTGGCGCGGCA
GAGAGTAAGTAGTTTGAGATTCGTGGAGCAGTGGCAGTGGGTACCCAACTCGGACCGTAAGGCGTGCGCAGTTTGTCTGCGAGGATTTTACTTCCGACGC
AAACACCATTGTCGAACATGTGGCGAAGTGGTTTGTTCGTCCTGTGCTTTGCTGAGAGAACTAGAGGAACCAATCTTTGAAATCACCCACTTGCGCGTTT
GTTCCGCGTGTATGACAAGTGCTGGGGCTCGACAGCAACAACAACAATTTTCGGTGCTAAGTGCGACCGGAACTGGAGATGAACCGGCGTCTTCTACTTC
TAATGACACGGAGTCGTACATCCGTGGCCTGCGCAGTCCGCAGCACAATACGTACGAGGACATGATCTTCCGGATGCGTGAATCACGCGATCGTGACCGT
CGACAGAGTGACCTAGCTATGGAAGTGCTTGAAGCTTCGTCCGACACCGAGCTGAAGCCTGCTAACCCCCCACGTAAGATCGATGTCAGCCCACAGTTGC
GCGCTCAGGATAAGATGCAAGCCCTCACTGATGTTGTAACCCACATCCGCGAAGTCCGTGATACCATCAATATTACGATGTCTGAGGCAGCGTACGGAGA
ACGGCAGGACGAGGATAGCGATGAAGTTGAAGAGTTCAATGACATGTACAGCGAGATCACAAGCATCCGTGAGGCGCTGGAGAGTTCAGTCTCGAACTTT
GACGCTGCACTAGCCAATGCTACGAATGCTGCGCCTGCCATGTACTACTCTGGACCAAGTGACCGCAGCCAGGATTCTTCACGAGATGGTGGTAGTGAAC
GTGACGGTGAGATGACGTCCGATCAGTTTAACTCGGTTGCTCGCATCACCTTCGCAGCAGCTCGGGCAACAAGACAGGCTGGTCAAGCTTTCTTGTTCCG
TACACTCTCAAGGGACAGGATGTCCGTAGGAGAGCGTCATCGCCAGTTGAACGAAGCTAACAGCGCTCATGATAACCAAGAGGAGCATGACGACGATGGC
GCAGTGTCGTCAAGCTCAGCTTCAGTTGCCAGCTATCCGACCGTGTATGATAGCGATGACAGCTCAGCCCAAAGCCCAGACCCGTATTCCGCATCTAATT
ACGAGAAAATCATGGCAACATATCAACCAGAGGACGATGGTTCAGAGCATGAAGATGAAGATGATAGACACTCCTCGCACAACTTTGCCGATTCTGTGCG
CCGCGCGACCGAAATCCATGAGCTAGAGAAGAAGATTCGCGACCTGCAGCGTAGCCTGCATGATGCACAGCGAAAGCTGTCAGTTATCGATAGCGACGAG
CCGGAGCCCGAAGCACGGTCGCACCATCGACTAGATGTTGTGCGGGATCGCTCCGCCCAGGTGGAAATCGAAAGTGTATTCGAGATCTTTGGCGAGCGTG
GTGAAGACAATAGCCCCATTCTTGGTGATACAGCGTCATCAGTCTCATCGGGCCCCAGAGCAATGTCTTTGCCTTCCGAAGCAATGGGGAAGAGAGGACT
AACGACCCAAGACCTGGTGTCAGAGCTTCGTGGTGTAATGGCTTCCAGCGAGACCCCTGTGCGAGCCAGCGGTGGTTCACGGAAGTCCATGTCTAGATCG
TTAACGCCTCCACTGCCTCCGCAAGTGGTAAAAACCCCAAGCAGCCCTCCTCCTCCCCCACCACCCCCAGCTTCTCCGCTGCTTGCTAAGAAGCAGATTT
CACCTGTTCACAATGTTCGCAAGCCAACGAGCAAGCCTACCAAGCCCAATTCCAGTTCTTCAAATGGTGGTCTCCACGACAGTCACGGAAGCTCCAAGAA
GAGCCAAACAGTTGGAACAAACCGACCTTCCGCTGCACCAACTGAGGGATCCTACTTGCAGGCTCTAGGCACAACCGGTGGTACCAGTTATGATGATGAC
TACGGTTCTTCATCGTCTGATGAAGAAAGCTACGATGACTCGTCCGACGATTTGTCGCTGCTCAGCAGCGATGGTTTCCGCGAGCCTCAGTTTAAGAAGT
ATCATGGACCTGATGCGTTTTACGTGGAAGAAGACTTAGGTGCTTTGCTGAAGAAGAGAAAAGCAGAAGAGAGCGCCTCGCCACCAATTAACCCAGCAGA
TTCGCCATCATCACCATTACCTCCTGCTCCAACAGTGGACAGGGACGAACGTGATGAGCTTCGAGAACTGATGGCAGGACTTGTTCGACCTCGCAGCTCA
TCGCTTCCATTCCAGTCAAGCCAGATGGGAGGCGCATCGTCTGGAGAGCCGCTTCATGACTATGAGAAACCCTCGTGGAGTGACGACGCTCCTGACCGTG
TCCCGACGGCACACCAAGTGGACGAGGCCGTACACGAGATCCGTGCCTGTCTGGCTAGCTGCCGTTGCGAGTGCCCGTCCGACACCGAACGTGCACGAAA
ACTTACTTCCATTTTCAAGGTTCTGCGTTCGCTACACCGCGAAGGTGTGCGCTCCAAGTTTCGCACGCTGCAGCACGATGACATTCGCTACTCGAAAATG
CTCAAGGCGACACCCAGCATTATCAAGCTACTCAAGCTCGCTGGTTACGTGTCCCTACAGCAGAAACTCACCATGCGGCGTGTGGATCAAGACTACCTCG
CTCTGTTTTTACGCGA