Description :
From Genome Similarity Track
Location :
Scaffold_1260:1672- 3188
Transcript NameFunction/comments
Phyag_g10084conserved hypothetical protein

Sequence
1516 bases(100 bases per row)
CGAGGAAGACCGCCATCCCCGCCGCAGTGCGTTCTACCGCTACTATCTAGAATACTTGGGAGATACCTATACTGATGGTGGTGATTGTTATTTGTTGCAG
CATGAGGTGAGGGAGCTACGTAGTGAAGCTCAGCGGCTGGATGAGCAGTTCGCGTCGTTGTGTGCCAAGTGGAGAGCAGCACTACCGGAACGCGATGTGT
TATTGGCGGCGTGTACAGCAGCTAAGCAGAAGGCGGTGACCGGCcgagtcgagcagctcaattTGCGACTTAAGGACGAACTGCTTCAACAACAATTGTA
CTtctcggcgctgcagcagaaactcACAGAGGCACCGTTGTGGTCGCGCTCAGCTGTGTGTCAAGAGCTATTCGACCGCATGCACGGCTACTTGCACCTC
GTTGGATCGGATCTTGAAAGTCGCAGggaacagcttcaagcacgGTTCGAACTGGGCGTGCGGCTTGCACCGGAGCTCGTGGAAAACTTCACGCGCGAGT
TTGTCCCGCTGACGTCGCCGGTGCTGCCGTTTTCAAGAACATCCACAGCGGCCACGACCATCTCCTCGCCGCTGAGTGTTCCGGTTGGAAACGAGAAAGA
TAAAGATGGCAGTGTATGCGGCACACTCGTGTCGAACATCTTCGTTTGCAAGATCccggccagcgccaacatccCAAAGATTTTCTATACCTTGGCTGAC
AACCTCAAGAATACCTCgatcgagctcgagcgccgTTTAGGCGTGCTGCTTGAAGTCAAGGTACCGATGGTACTGCCTCCTGCGTGGCACTATATCTAGT
ATTGATCATCGTGCTTATCTACTTGTTGCTTGTGCTATTGCAGTATGAGGTCGAAATGGGGCCGTCGACCTATTACGCGCGAGTGGAGCGACAGGATGGC
GAGATGCGAGGGGCCCACACGAACCGAGCGTGGACTGGGAAACTCGTGAGCGACGACTTGGCTGTGATCGTGACGGACTttgtggacgaggacgatgaag
aagacaccgacgctgctcgaaaggaagcacaagaagcgcaggTGGGCAATGATGGAGTGCCGTTGGTTCCACCTACGTCGAAATCGGGACTCCGCATCGA
CATTTGCATGGTGCTCACTATTGCGCGTGTGAAGGATCCTGAAACGCAGGAACCGGTCGTTTTAATGCGTCGACTGCGTGTGCATCGGTACAACCTGCCA
CCTAATTCTCCAGTGATCCACCGCGAGCTAAACAAGCTGCTCTCGTATTTCAACGGCGACTTCCACATGGCCATGCTCAGTGACGCGTTTATGAGCATGA
GCAACGATGACCACTCGTCGGTCGCTGCAAGTGAAAGCGTTCGGTCCGAGTCTGAGGACAAGCAGGTGATAAaggatgaggaagaagaagagcaagagca
ggagacgcaaaaggaagtggaggaagcggaTTCGGACGAGGATAGGAGCGTGAAAAAGCGCAAGATCAGCCCCGTGAAGCACGAAGaagcgacgccgacg
cccaGTGCAAACGAGA