Description :
From Genome Similarity Track
Location :
Scaffold_77:167188- 174063
Transcript NameFunction/comments
Physo_139696hypothetical protein

Sequence
6875 bases(100 bases per row)
GAGGGATATAAAATCTTATCTGAAAGGTCAGATTCACCATCGTTCATGACCGCACGTTTGCTCGCCCTGCATTGTGTAGCCATTTCTTCGGTGCTTTATT
ACCCGTAGCTTGGTTATTGATAACATGGTAGCTCAGCTGATGCTGGCTGGCTCTGTAGACGTAGACGTCGAGATGTTGATACTCACAACTTGGTCTGGGT
TAACCCGAGGCAGGACGATCTTGGATTCGTGAGCGTATCGCTTGTACTTGCCATTGCTACAACATGACAGGTCATCACAGTGTTAGTAGTGTCGTACTGT
GAGCCCCCCACTTCCTTTGGCACGTACTAGAAGCAGAAGATGCCGAACGTCGCTAGTGTCACGACGACCATAATCCACTCCGGACTGACGAAGAAATTCT
TGAACGATTCTCGACCTGAAGCGTCCACGCTCATCCTATGCAGCGCACTCAGACCAGGCACCGCAATGGCCGACAAGAAGTTCCCGCAGAGCTGCTGGAG
CGCTGCGACGGTGGCTTCGCTCGTCGGGAAGGCACACTCCACTCCGAGTTCCAGTACAATCGGCTGAATCGCTCCGAGCACAGCCCCCAGTACGAGTAGA
CAGACAAGGGACGCGTGGATCTCCGCCTTGGGAATCAATCCGAACAGTGCGACGGACAAGGCCGTCACCAGTAAGCAAATGAGCGACGCGACCTTGTGGT
TCCGCTTCTTGTCGACCTGCTGGCTGATGATCTGGCCCCCCACCAGCGAGCTCACAATGAACGCCGCCCCGACAATGCCGATCTGGGTCTTGGACACCGG
CGCAACGCCCAGAAACTTGTCCAAGAGCGCACTAAACGCGTTGATGATGCACTCCGCCAGTGAAAAGGCCACGATCGTGTGCCAGAAGCCACAGTGCGTG
AACGCCGTCCACCATTGACTCCAATCGTACTTGATGGCCCCTGTAGTCGAACTAGACGAAGCTGAAGTCGAATTTCTGGATCCAGATTTCGGATCTGAGC
GAAAGAAGACGCCGGCGACCACGCACGACATCAGCGAGAGCAGCGCAAGGTACAGGTTCCAGTCTGGAACATCATCGCCAGAACGAACGATGAACGGGGC
TGTTAAGTAAACAAGCGCAGTGCCCAATGCGTTGGCGTTGAGAGCCACGCTGGTGGACGCCGCTCGCATGGACATGGGGAACCAGTTCGCGGACAGAAGC
GGGGGCGAGTTCACCATGAACGGCATGGCCAAGGACGCGATGGTTTGACCCGCCAGCGTCACGTAAACTTCCTCTTGGGGCTCGAACACGCAGGCGAAGT
ACCGCAATCCAGCCCCCAGCGTCTGCAGTACTCCTCCAAGTATCACCCCATAGGCCAGACCCTTCCGGTCCATGATCCACGACCCGATGAAGGTGCACGG
GATGTAGGACACGAAGTAGACGGTGATGAGGTGCTCAGGGAGGAGCTGGGGACAACAACAAGCACGGCAGGTTAGTGATCGATCGCTTCGGAGCAGACCT
TTTAACGTACTCGCTGTTCCCATCTCTCCTCGACGATGGTGGAAATGGGCGCGTACGAGTAGCAAATGGCCTGGTTCACAGCACTGAGCACCGAGAGGAT
CGCCAGCATGACCCATTTCCCGTAGGACCCTCGGGCGAACGCAGACCGCTTCTTCACCGGCCGCTTCTCCAGCAACGTCGCTACTGCTCAGTCCAATACA
ATGCATTAGACATAGACACCGTTCGAGCAGGAGAGCTCCAACACAACTCAATTCCTTCGCATACCTTCGACCTCGAACTCCGGTTCTTCGGGTTCTTCTT
GCACCAGCGCCGTCATCGTCTCCAGTCAAATAGAAGAATCACCTGCCAGCTGCCACCAAACGGTTTAGCCTCGCAAGGACGCGCTATCCATGGAGTTGAC
TCCGTCCAGTGCGCTCTGCGCCTACAGCAGCGGCAGCGCAGTGCAATGCGTCGACGCACCTTGTGGTCGTTGACAGGCAGGCGGCAGATGAGATCTTTGG
CCTCGGCCAACCAGGCGCCTTGGCGACCGCACATCCTTTAGGGCCCGTTCCAAAGGGTCTCTATGCCCCCCAAATGCATCCAGTGCAGACGAACGAACGC
ACTGCTGATTTAGAGCGATGGATTAGTTATTAGCGACGTCGGTGGATGGGTGCGGACTATCAGAAGAAGCTCCCGGTGTCTCGGGACGTCCTCGTGATGA
GAACGTGCTCCTTGTTGCTGCTTCGACCGCTGGCTTTCTTGGACTCGTGGGCGAAGCGCTTGTACGTGCCGTTGCTGCAGATGCAGAGAGACATCAACGT
TAGTACAAGGTGGAGCAGAGGTAGCTCGAAGAGGATCTACGTACAAGAAGCAGAAGACGACGAAGGTGGCGGTTGTCATGAAGACCATGACCCACTCGGG
GCTGGCGTAAAAGTTTCTGGGTGGCACGTGGCCCGTTGAATCCACGTGCGTCCTTCGGAGCGCACTCAAGCCAGGCACGACAATGGCCGACAAGAAGTTG
CCGCAGAGCTGCTGCAGCGCGGCGACCGTGGCTTCGCTGGTCGGGTACGCGCACTCGACCCCCAGCTCCAGCACGATCGGCTGAAGCGGACCGAGCACAG
CTCCGAGGAACATCAAGCTCACGAGCGTCGCGTGGACGTTGACCTTGGGCACGAGTCGGAAGGAGGCGACGGCGACCGCCGTCAGCAGCAGACAGAGCTG
CAGCGCCGTCTTGTGGTTGCGCTTCCTGTCCACGTACTGGCTGATGACCTGTCCCCCGATGAGGGAGCTGACGATGAAGGCAGCGCCTACGATCCCGATC
TGCGACTTGGAGAAGCGCGCGACGCTCAGAAACTTTCCCAGCAGCGCGCACATGGCGTTCAGAATGCACTCAGCGACCGAGAAGGCCACGACGGTGTGCC
AGAAGCCACTGTGTGTGAACGCAGTGGCCCATTGTGCCCAGTCGTACTCGTCTCGAAGCTGGACGTCGGAGACAATGGACTGAGCCACGCCTGTCCTTGG
AAAAGACTGGAAGAAGAAGAAGGCCACGACCCACGACGCGGTCGCCACCAACGCCACGTACAGGTTCCAGTACGGGACGTCGTCGCTGCTGAGCACGATG
AACGGAGCCGTGAGATACACGAAGGCAGTGCCCATGGCGTTGGCGTTGACTGCGACGCTGGTGGACGTCGCACGCATTGAAGGCGGGTACCAATTGGCGG
ACAACACAGCGGGCGAGTTGACCATGAAGGGCATTGCGACGGACGCCAGGATTTGGCCCACCAGCGTCACGTAGGCTTCTCCTGCGGGGTGAAAAGCGCA
CGCGAAGTAGCGTAACCCCGCACCAAGAGCTTGTAGCAGTCCGCCGAGTAGTACGCCGTATCGTAATCCCTTCTTGTCCATGATCCACGAGCCGATGAAG
GAGCACGGGATGTACGAGATGAAGTAGACGGTGATCAGCTCCGTTGAATGGACCTGCGCATGGGGATAATATTAAGCTATTGATGAAGAAAGCAGTATAC
ATCTGCGTCAAACTCACTCTTTCCTCCCACCGCTTCTCGACGATGCCAGCAATGGGTGCGTACGAGTAGCAAATGCCCTGGTTGACCGCGGTGAGGACCG
ATAGAATCGCCAGCATGAACCATTTGCGGTAGCAGTCACGAGGCGTAGTCGTGGGCGTCTTCAGTCGGTCCTTTTGGCCGAGAAAGGTGCCGTAGTCTGC
GGATTGAAGCGTTAAGTTGTGCGTAGAACTAACTGCAAGAACTGCAGTCGTGTGGACGCACCTCCGCTCTCCATGTCCTCGTACAGTATCGTCGCCATCT
TCTTCTCGCCTGTTGATGTTTCGTGTAGCGCGAGCATCTCGCCGCTATTCAGCAGAATGCCTACTAAGAGACGCTAGCCCTGCCAGTTTTTTTGTGGTCG
ATCCCATGCTGCGTGGGCTAATTGAGGTCTCTGGAACTGCTGAGACTTGCAGCACAACACTTGGTAACCAAGTGTTGTGATGGCAAAAATGGAGTTTAGG
CCGCCTTTTGGGGGTTTAGGCGGGTGTTCTCTGTGTTATATCTCAGCTTCTAGAACGTCTTTTCAAGTGAAAACGACTGTTATGAATTCCTTGAGCAAAG
CGCAGCGTTTTGACGAAGATTCAACGCGTATTTCGGCGTATTAAGAAATATGATAATTTTGAAAAGGCGGCATGTGCCACCACTGACTTGGTTCGACTGT
AGCTCAAGTGAAGGTTTCGAAACCACCTTTGAAGTTGCACGAAAATAATCAGCAAGGCTCGACGCGGACTCCGTCACGTGCCGACAGCATCAGCGTCAGC
TTTGATGAAGACGCTCAGCCTGACCGTCAACTTTGATCCAGGTGTTGCACTTGCACGTAGTTGTGGGAGACCGAATCTAAGCGTGGATGCAAATCGCAAA
CATACCAGACATAACTGCGTTTGATTCTTAAAGCTACAGGCCCGGTCTATCCTAATGTCGAGGGCAGACTGCATGACCACGAGATAATTGGACGAATGAA
AGAGATGCCCTCAGCATTTCAACCATTTCTACGCCAAACCCGACAACCGGCCCACTGAGCTCCTTCCATAACAGAAGCAGTGCTACAGTGTGCAGCGGCC
GCTCCGGCGTTGACCAAGCGCAGTACCAGTGTGCAGTGCTGTACTGCGCTATCAACGTTGTGGCCTAGAGACGAAACATTGTTGGGCTTCATCAATGCGA
GCAGCTCTCTGAGGTATGGCGCGCTCAATGGAAGGATGGAGGGCCCACAGAGTGTGTATACCTCATCCTGGCGAGGTACTAAAGGCCAACACCAACGCTC
GGGCCGCTATTTTGCGCCAGGTTCTGCGTCGACCGTGTTACCATAACTCGGAAAGATTACCGTGTTACCATAACACGGTACGACGTCCATGATGCCGTAT
ATTGGCCTCCTACGCCTATTGATCCAGCTCGGCAGCGCTGGATCGTCGCGCTATCAGCTCCGCGCGTCCCTGCATTGCAGTTTGCAGCCTACTGTGCCTC
TGATGTTCATTCAAAGAGATCTATTCTACCGCAGCGCATTCTTTGTGTTTTTGTCGCCCAAGAAGACACACACGAGGCAGACTGCCTGGCCCTCCTGGCT
TCGGTAGCCTGCGTCGATTGTGTGAGGGCGGACTCCAGCTTAGACCGGCGGCTCAGCGTCGAGCGTGTCACCGACGCCGCTAACTCACAGACAGTAGTGG
TGAATTACGTCGCCTTCGGTAGGTCCCAAAGGGTGAGAGGTGTATGTGTACAATACGTACGCCACGAGCCCGACCAGCTCGGTCGTGACGGTCAACATGA
ACTAGGGCTTGATGGCCACGCTCACGAACACCCGGCACCCATATGCCAGAGGTCGCAAGATAACGCCAATGGCGCTCCAGTACCGACAACTCGGTACTGG
ACGTGTGGTGGCGTTTCCAAGCAGTCATAGGCCACGAGCCATGCATTCATCACTACAGAGTGTAGGTGGTCGACAGCCTTAGACTCTATGCATGCTCGTG
TAAGTGTACGTGCAGATATGTTGACTAAGCTTACCGTAATCAGTTATCTACCACCCACCAGTGACTTCACGACCAACTCTAAAGGAGTATGACTGAAGCA
CTCCGTGTGTGCTGCTCTAAGTATTTGGAGGGATCGTATATCCAGACTGAGAGCTGGCTAGTGTGAGGGTCGCGGCCGCAACACTCACGCCTTCTGAGAT
CTCCCTGTATTAACCCTTTTTTACTGGGATAGGAAGCAACGTTAGTGCTGCTATCGCAGACCAAATAGGATTATATCCGTGGTACATCAAGTCAAACGAT
GACCCCTCTTGACATCTAACTGGTATATTTCTTGAAACCGGTACGACTCTGGTGCCGCACTGGGCCCGGTTTATACGCGTGGGCAGACTGAACCGGTAGG
ATACCCATCACACCGATATGACCCCGGTGTCGCACTGGGGCCGTTTATATACGTGGGCAGATTGAACCGGTGTGCTACCGACGACACTGGTATGAATCAG
TGGCAGGGTACGGATGGACGAAGAGAACGCTTGGACTGTACAATAGCACTAGAGGTACTCAGTATGTATTTGCATTTTCTACAAGCTGCAAAACAGATCT
CAACCAAGGTTCGCATTTTTAATTTTGTACTAGTAAAGCATTGCCGGTAGACAGTTTGAACTGGCAAATATCCGGGCAGATGCTGCGGCTGCGAAGCAGG
CGCAGGAGATGACCGTAGCTAATAAAAATAATGAAAAATAAGAAGAAGGGGTTTATACCAAAATTCTCCTATCCCAGCCTTCGCGGAGCCCTAGTAAGGT
TTTCACCGCTAGGAGAAAGCAGCCTCATTGCCACCATGTTAACCAGCGACGCTACCAAAAACGAAGGTGGCACGTATCAGCCAAGGGTCGACTGTTTGTT
TGTTTTTGAATTGAGATAACTATTGTTGTCACTTAGCTAATACGATCGCCAAAGCCAACGGCCGACTGTACTTCGATGTCTACTCGCGGATCGGCGTCCG
CCGGCGGTAGCTTTCTTAACCCCCCCCCGCACTCATACGTTGTATATGACTACATGTTATGAAAAAGAACAGCACGTCCTTTTCTACGTGAAATACACAG
GTGCAGGTGCAAATATGCACAAAGAACGAGTAGTAGCTGCAGAGAATGGTGAATTAGACTGATTATTTGATTGCTTACAGATTACTAACAGGAACCGCTC
TCCCCATCATGCGTATGAGACAGTGCTGCCCTGGGTACTCTGATCAGATTAGACAGGATATGATACATGATTGTGCATAGTAGCTCGAAATGCAAGATGA
ATCTCCTCCGATATACCAGGGTATGTAAAAGAAGAGGTAAGCTGGAAAGAATGAACACCGTAGACACTATATTTT