Description :
From Genome Similarity Track
Location :
contig_5:167178- 178145
Transcript NameFunction/comments
g1521.t1POM75574.1 Hypothetical protein PHPALM_7310, partial [Phytophthora palmivora var. palmivora
g1522.t1OWZ24294.1 Nucleolin [Phytophthora megakarya
g1523.t1RAW34157.1 hypothetical protein PC110_g9517 [Phytophthora cactorum
g1524.t1XP_008897152.1 hypothetical protein PPTG_05368 [Phytophthora parasitica INRA-310
g1525.t1RAW34150.1 hypothetical protein PC110_g9519 [Phytophthora cactorum

Sequence
10967 bases(100 bases per row)
CGACCACACGTGCAAATGGACTCGACGCTCGACCAGCTGCAGCGCACAAGCTCTTTTGCCTCCAGGTGGCTCTGTCGGTCTTCTGTTGCGACTGGCAATC
GGGTGTTCAGCACTTCGCAACCGCCGTCCCACACGCGCCTTTCGGCCATCAGTTCGCCTTCTCATCTGGTTCGCCTGTAGCCATGAGAAAGTCTATTTCG
CTGCCGATCGCGCCGCCTGTCAAGCTGCGCCGCCGCAAGTCGTTGCGGGAGGAGCAAATGAGTCGTTCATTCTCGTTCACCAAGCGCCGCGTCGAGCGGC
AGTCGTCGCGCCTCACACCGATGAAGTCCATGGAGCAGACGCTGCTGGACAACGTGCACGTGGTTCGTCAAGGCCGTGGTGCCCGGCCAGAACAAGCTGG
CCAGCCCGCGCTACGTCATGCGCATCAACAACACCGCGCTGGACCAGACGTGGGAGATGGCGAGGACATTCAAGGAGTTCTACGAGCTCAAGGAGGCGAT
CGTCCGCGTACTCGACTACGGCCACTTCTGTCCTTCAAACTGCCCGTGGCTCTACATGTACGCGGCGCACCACTTCCCGAGGCGCCACATCTTCCGTTCG
CGTAGCCCTTCCGTGATCGCCGGGCGACTCACCGAGCTGCAAACGTATTTTTCGACGCTGCTGCGCATGGCCAAGCAGAACCGCAACCTCGAGTGCGCAG
TGTCATCTACCAAGCTGCCGCAGCTCATCTACGATTTCCTGTTCGAGGGCATGGTTTTCGACCGCTCCGACTTCATGCGGTTGAGCGAGCGTCTCTCGAT
AAATACCCGCGACAGCAGCTTCCTCGACAACGACCCGACACAAGATCCGGAGGAATGCTTCATCTGTCGCAAGGCTCTGGTGGGCGACTCCAGCGTATCG
ATCGTCCCAGCAGCTCCAAGCAGTAACAGGGGGCCTTCGAGCAAGAAACGCGATAAGCACGTGATGGCGGGCCTCACGACTCTCGACTGCGGCCATTGCT
TCCACGACGAGTGCATTCTCGCGAAACTAAACGAGTCGCTGACTTGTCCACTGTGTATAGCGCAAACCAGTCCTCCACAGTCCGGCGTCGCTGCTGCCTA
GTTAACAAACAACCCGTGCACTAGAGACCTCTTAACCTAGCTAGAAGGCTGTGTGTACTTGTTCATAAATGACATGGGAGCCATATTCAAGCGCATCAAA
CCCCATTGCACCGTGGAGATTCATATCACCTCCAAACGATTAAAGTGCAGCAATACCCGCAGCGTGGCTCTTCTCGTCGTTTCGTCTACATGAAGCCCAC
AACGAGACGGCAGTGACTATCTCTTCACGCTCAGGAGAAAGGCTCGGCGGTGTCGTGTTCTGTAGTACTTGTCTGTCTGTGTAAAACCCATTTTTTATAT
CCAAAAAACGAATAACCCAATACCAAAATAACCCATTTATAGTAACTTGGGCATGAAGCGTGGGAACGTCCGCAACCAGGAGGTGCGTATCCCTCTCTGT
CTCCCCCTCCTCGCTGTACCGACGGGCTTTTTCTCGGATGCGATAGGTAGTCAAACTCATCGTCTATCACTTCCACCGCTTTTCCGCAGGTTACGGACGA
GCAAGGCCGCCGGCGTTTCCACGGAGCCTTCACGGGCGGCTTCTCTGCTGGATACTACAACTCCGTGGGTAGTGCGGAAGGATGGACGCCACAGACGTTC
TCGTCTTCTCGGAGCAATCGCTCGTCCCAGATCCAGCAGCGGGCTGAGGATTTTATGGACGAGGACGACGACCCGCTGCTGGGCAAACGACTGGAGACCA
CGGAACGCTATGACACGCTGCAAAAGGGAGCCAAACGACAACTGCAACAGCAGCAACAAGTTGGCAAAGCTGGAGCTGAGCTATCCCAGGGTTCGCCTTG
CCGGATGACTGGGTTCTGCCGGTGAACGACTCCGTTGGAGCTAAGTTGTTGAAGCACATGGGGTGGAAAGAAGGTCACGGCATCGGGCAGCGAGTACGCA
GACGCAAGTACGAGGAAATGGAGAAGGAGGGAGTGGAGGGACCGAAACTATTGATGCAAAGTGCTCATGAAGAGAAAACAGAGTCAGAGCCGCAGGATGA
AGAAGAGGTGTACGTTCCGCCACGGAAAGTGTTTGACATTCAAAAGGCTTTTCCCAAGCCCAAGCTGGATCGGTATGGCGCGGGATTTGACCCGTATACG
AACGCTCCCGAGTTTGCGTTCCACAAGCAGCAAAAGGAGGAGAATCAGAGAATGAAGGAGGGGTCTCACCGTCAGGTGGTATCCTTTTCAGACGCTTTGA
AAGCTTCAAATGGCAGCAATCGCGCATCGGGAGGATATGGACTGAGCGCGCTGGAAGAAGACGACGACGTCGATGTTTATGGAACTGTCTCAATGACAGA
ATTTGATCGGGTAATTGCCCCACTTGGAGCGAAGAATGACATTAAGCGGCTGGATTCATCAGCACTACCCGCGCGTCGGTATGAGAAGGCAAGACTCAGT
CGAGCTTTGTGCTCAGATGGACGACCTGTCCTTCCTGGGTTTGAGTTAGCAACGTCGAAGGAAAAGCCTCCGAAGGTAGTTAAATTGCGTCTCACTGTGC
CGTCGGATTTCAAGGCCTTTCATCGCTTTGATGAGGAAGGAGGGCGCGATGATGCCGTAACAGCGTTGTATCGCAAGCATAATTTCTCCTCGGGTAGCGG
TGGAATGGTTGTAACACCGAACCAACGTGGCGTTCTCCTGGAAGACCAAGGGGAAATGGACGTAGCAATGCTGGCGCGGGAGTTGGTAGCGAGGTGAAGG
GCCCAGCTGCGAGTGTGTTTGACTTGCTTGGCGAGGAGCAGAGGGCGAAACTGTTCGATGCTGCTGCTCAAGCGAAACAGGGGCTACCTTCGTCCAGAGT
TGCACATACTACTTCAGTCAAAGAGTTAGCCGCTCCGAAAGTTCGGCAACCACTTGTGCGTGGTGGTAGTGGTGACGACCAGTTTCGAGCAACGATTTCA
GCGTCGATTGCGAAACGATTCGTTTCGTCAAAAGGTGCAAGCGACGAGGAAAAGAGCAAGCCTGATCCTACTCAAGAGGTTCACACGAAGGCGTCACGCC
GGTCGCAGAGTTTGTGGATCCCCGAATCACTTCTTTGCAAACGTTTCCACGTAAAATGTGCCGGACCGACTGGCTCTGGGGGAAAGATGACGATAGCGAC
AAGAAGCGTGACCTCTTCGACAAGGAGCTCGTTCCCCATTTAGTAGAATTTGCCGCTGACCGAGCTGCTCATCAGCGTCCGCCAGAGAAGGCACGTGAAG
CTTCGAAATCGGGCAAGGTTGCTGAAGATGAACGCGTGCTGCCACCTTTACCTGCAGTAAAACGAACCTCGGCCAGTCTGCTCAAATCGATTTTCGAGCC
GTCGGATGAGTCTGAATTGAGTGACTACGATAGCGAGGATGAAGGAGGCGATGACGGCAATGTAGAAGAGATGGAGAAGCAAGATTCTGCCTCGAGCTTT
CCCATCGGGAGTGCTGAACAACTAGTGCGAAATCATCAGCACGACCAACGTGACGTGAGCTCAGAGTCAAGCTCGTCAGAAGATGAGGTTGGTGCTCACT
CCTCGATGCTTGGCGCTAAAGTTGGCAATAAAGAAGATGACCGAGGCATCAAGCGACTGCGCAGTGAAGATGACACCGACAATGGAGATGCGAGACAAAA
AAAGAAGGACGAGAAGCGGAAGCACAAAAAACACAAGAAACACCACAAGCATCGCTCGTCGCGTGACGACAAGGACAAGAAGAGGAAAAAGGACAAAAAG
GATCGAAAGTCGCACAAGCACCGCTCCTCGAGACACTCCAGGCGAAGCAGAAGTCGAAGTGGGGAACGAAGCTCGGGTCACCGTCGTAGCTCCAGCAAAC
TGCACTAGCAGTAAAGCTGGAACTTCAGTTCTCTACTAACAAGAGTACTTCAGTAATGGAAGGAGTAAACCGACGCTGTTGACACGGCGGCATGGCGATT
ATTTCGCGTGGACTAGCCCAAGCACTTCAACTTGAACACAAAAAACGAACAAAACATTTTTGAGTCTCTATGTAAACAGAATCGATTGAAGCTCAAAGCA
ATGCAAAAACTAATCAATACACGACAGAGGGCTGGCCCCTCTACCGAGTCAAGCACCGTTGCCTGGCGCTCAAAGCGCATGTGTCTCCCTGTGTTCGTAA
TCCTGGCCTATTTGAAAGCTATCCCGCTCACAGCAGCCGCCATTAAATTAGTCGAAGGTCTTCTTGTTGCCCTGGAAGTTCTGGATGGACGACGGCTGGC
GTCTGGGGGGACCATCACCACGGCCACCACGGCCACCGCCGCGACCACCGAAGCCACGGCCACCACCACGGCCTCCGAAGCCACGGCCACCACCACGGCC
TCCGAAGCCACGACCACCGCCACGGCCACCATCAAATCCGCCGCGGCCTCCACGGCCTCCACCACGGCCGCCAAAACCACCACGGCCACCGCCGCTGTGC
TGCTCGCGGCTCTTGGCGTAGTTGACGCGAATGGCACGGCCGCTCACGTACGAGCCAGCAAGCTTCACAGCCTCGTCGACGGCCTCAGTCGTCTCAAAGT
CAACGTGGCCAAAGCCACGGAACTCGCCAGTCTCACGGTCCGTGGCCAAACGGCAGCTGAGGATTTCACCACACTCGCCGAAGGTTTCACGGATGGTGTT
CTCATCCACGTCCCAAGACAGGTTGCCAATGAAGACGCTCGTGCAGCCCTCCGGCTTCTCGTCGAACATGTTCTTCTTCTCGGCCGTGCGGATTTTCATC
CAGCGGCCTCCAAAGTCTTGGCCGTCCATGGCAAGAGCAGCCTCAGCAGCCTCCGGAGTAGCGAAAGTCACGAAAGCAGTACCCGACGAGCGGCCGTTCT
GCAGAGGGATGCGAGCGCCAGTCACCTCACCGCATCCGGCAAAGTGCTCCGTCACCTCCTCCTCCGTGGCGGACCACGGCAGACCGGCAATGAAGACCTC
AAGGTTTCTTCTGCGGGTTGGCAACAGCAGCGGCCTCGCCGTCCTCCTGCTTGTGGACCTTGTTGGACTTCTCACTAGCGTCCGAGTTCTTACGCTTCTT
GGACACAATAGGGGTCTCCTCCTCGTCCGAGGACGAGTCCGAGTCGCTGGACGACGAAGAAGACTCCTCCTTCTTGGCAGCAGTCTTCTTGGCAGCCGGC
TTCTCAGCCTCGTCATCCGATGAGTCCGAGGACGAGCTGTCGCTGTCCTCCTTCTTAGCGGCAACCTTCTTGGCAGGGGCAGCCTTCTTGGGAGCCTCCT
CCTCATCAGACGAAGAGTCCGAGCTCGAGTCCGAGCTCTCCTTCTTAGCGGCAACCTTCTTGGCCGGGGCGGCCTTCTTGGGGGGCCTCCTCCTCATCAG
AAGAAGAGTCCGAGCTTGAGTCCGAGCTCTCCTTCTTGGCCACCACCTTCTTGGCAGCAGTCTTCTTAGACACCACCTTCTTGGGGGCCTCCTCCTCGTC
GGAGCTCGAGTCGGACGACGAGCTGTCCGAAGCCACGGGCTTCTTGGTAGCGACCTTCTTGGCCACCACCACCTTCTTCTGCGGGGCCTCGTCGCTGCTC
GAGTCAGACGACGAGCTGTCGCTGCTGGACGCAGGCTTCACGGCAACGGGCGTTTTCACCTTCTTGGCCATCGTGTGTAGAGCAATTGGAGAGTCGGGAG
CTGTCGGGGCGTCGAGCGATTGGCAAATGACCAGCGAAACACTCGCACAACAGGCCGTTGGCTGGGATACCTTCAAGCGTCAGCACCGGTTTGGTTGGCT
GCCGCGCTGCATGGTACACTGTGCCGCGTTTCATGTGAGCCACACGAAGTGTGTGGTGCACATGAAGCCAGTTCGTGAGGTTTTTTTCCCTTTCTCCCCG
AGGCTTTATGTGTGGCGGGTGTGGCCCCCCACACAACGACCACACAGTCTTTCTTTCGAAATCCGGCGCGCGAATAAATCCTAATAATGGTGGCAAGTGG
CGACGAGAACGTGGCGGTGGACGTGGCGGTGGACGTGGCGGTGGAGGACGCGACCAAGGTCGAGCACGAGCCGGTGGTGGGTGAGAAGCGCCACGAGCGC
TCCGAGGACATGGACCCGCTCGTCCCGGACGTCGACGTCGACGTCGACGCCGCAGCCTCACAGGACTCGCAAGCGACGCAGGACGACGACATCCAAGACG
TTGTGGCTAATATCAAAGAGGCCACGGCCGTCGACGTGACGTTCGACGCCGCCGCCGCGGCTGCAGCCGTGGTGCCGCCCCCCGAGGTCATGAAGACTGA
CTCGTCCACGCCCGTGCAAGACGCAGTCGCGGCGGCCGCGGCGGCTGGCGTCGGCGTGGACCCGAACGGTGCCGCCAACGTCAAGTTCGACAGCAAGCGC
ATGGCGCGCGTGTCGTTCAACTCGTGGTTCGACTTCGACGCGTACTTTGAACTGTACATGCAGGAGACGTTCCAGCCGTTCCGCATGCGCTCGTCCTGCA
GCGTCGAGGCATACCGCCGCAACCAGCAGAAGGTCATGCTCAACAACAAGAGCTCACGCGGACGCCGCGCCGAGTTCCCGGACGAGGCCATCCACCACCA
CCGGATATACATGTGCACGCACGCCATGAAGGCGCGCTGCCGCGGCGCCAACACGCGTCCTGGGCAAAAATACCGCGGTATCGGCTGCATGGCCAAGATC
AACGTCAAGATCACCCCGGCGGACAACCCGTCCAAGTACATGGTGATCGTGACGGACCAGGTACGAACGGCACCCGATTTGCTTGGTTATTTATTGTGAT
TTGAGATTGACCCGTTGTCTTTTGCTATTGGTGCTGCAGGTTGTGTCGCACAACCACCCGGTGAGCCGCGAGATTTATGAGGCATATCCGGATGTGCTGC
TCAAGATGATGCGGCGCAGCCAGCTGTCCCAGTCGATGCTGGGTCACCCGCCCCCGCCCAAGTTTGAGACGCCTCAGCAGACGCAGAAGTACGAGCGCGC
GATGAATACGTTCCAGTCGATCGCCGAGACCATGGCTCGGCTGGCTGACGAGGACTACGAGCAGCAGCTCGGGCAGCTGCAGCGGCTCTACACCCCCGCC
ACGGAGCAGGATCAAACGGTCTGAGTATGAAGTCGCGAGAGAGGCGAACGGTGGCTATATACCAATACGCGATGAGAAGAGGCTGCCAGCGAGATTCGAT
TTTTGCTCTTGCTGTGTAGCAACGTTCATGTCCAGCATTCATGTGCACGCTAATGCATCGTTGTCACTTCACTGTGGCTCATGGGTACACAAGTTTTACT
ACATCCACAAAATTTGATTACCTTTTTGTGTATGCAATGTGTATCATTTGTGTTTGGTTTGTGTACCGAGGGGGAACTGAGAACAATACACGACATCTGC
ATCGCAGCCTCGTAACCGAAGCAGCGATGGCGAGCAGCGGCGTGGACGTGGCGCTCGCGCCCAACTCGAGCGTGATTCTAGAGCCGGCGGACTCGCTGTC
CTTCCATCTGCAGCCGCAGACGGCGCCCCAGGCGGTATTGACGATCCGCAACGTGGCGGACGACCGGCAGATCGCCTTCAAGGTCAAGACGACGCGGCCG
CTGCGGTACCTGGTGCGGCCCAACCAGGGACTGCTGGGGCCCAACGGCTCGGCCTCCGTCATGGTGATCCTGCAGCAGAAAGACTGTGACGAGCTGCTGC
GACTGGACCCGGCCGAACGCCAACTGGCCAACGACAAGTTCCTCGTGCAGAGCATCTACGTGGACGACAGCTTCTACGAGCTGGTCAAGACCAAGTCCAC
CAAGGAGATGGCGGACGAGCTCACCAACATGTGGGCGCGCACGGACAAGCGCGCGCTGTCCAACAAGAAATTGCGCTGCCGCTTCGTGCAGGACAGCGAA
GAGTTGGGCCGTCCGCCGTCGCCGCCGAGTCCACAGCGAGCGCCGTCGGCCAGCGCCTCGCCGGCCAAGACAGCGACCACGTCGGACATGAGATACCAGA
GTAGACAGAGCGACGAGGTCGGGGACGAGGTGGCCACGCCCGCGCAACTGTCGTCGGCATTGCTGCAGGACGACAAGCCGCAGGCGCCGAAAGTGGCGGA
GAACAGGGAAGGAGGCAAGGAAGCGATCCAAGAAGTTGCGGCACTTCGGAAGAAATACGACGAGGTAGGTGCAGGGTTGAGGTACTGTGGTGACGAGTGG
GGCTAATGGAGGTGCGTTGTGTGCTTGATGGTGCTCAGTTGGTGGCGTTCACAGTGCAGCTTACGGCTCAGCGCGACGTGTTGATGAGCGATCTGGACAA
GACGCGGCAGCTGCTGCAGAAGGCGAGCACGGATGCACAGCGCGTGAAGAAGCTTTCAGAGGAGTCATCGACTTGCGTCATCGGAAGAACAACGGAAACG
GAGCTTCTGGTACGGAGGACTCGCAGGCGATTACGGGAAAGGGTCCCAAGGAACAAGGGGTACGTCTTGGCTCATGTTGATACGATAGGCTATGCTGGCA
ACTGACAGGTTTTGCTGTGGCAGGCTTTTGGACCCTTGCACCTGCTGGTGTGCGCGATCATTTTCTTTTTAGTTGGGCGCTACTACTAGGCAACTTGCGT
GCTACGTACGTACGCTGGAGTTAGGCAGAGACAGAAGGTGTTGCTGATGAACGAGGGAGGCAACAGCACGCTTGAAAAAAAAGGAAATTGAAGCAATAGA
GCTTTCTGTCGAGCTGCGTGAAGACGCTGACTCGTGTTCACATGTGTGGAAGTAGGCCGGTAGTGCAACAATCTTGGTTACTTCAAGTAGACGAGAATCA
TATAGTAGGAAGAGTACTACGTAGTAAGTAGACCGATTCCGGACAGGAACCCTTCGGGCCTCTTGGTTCATGGTCAAACTGTCAAAAGTATTCGTGGAAA
CGAGACTTGCAGTGAACTTGATGGTGCGTTTGATAGCGGCAGATGGACTACAAGTTACTCGTACAACGCCCTCTTCTTGAATGTCTAGATCTGACGGATT
GACATCGGCAGTGTTGCTGCTATAAAGTCGGGTTGTGCTGATGTGTGGCTAGTTGAGAATTGCTGTGACGCTCATTTTGCGCTTGCCTTCCATGTCTAGC
GGCGCGCAGGCCTTGCGCTTAGCATTCCGAGTGCGGCAACTTTCCGCGGCACTGTCACCGCCGTCGCTGCTGATTCCAGACGCGTGCAAACCAGCGCTGT
CTTTCATAGAAAGCATCGCAATTGCAGCTGCATCGCTGTCCGATTGGGTACCGGCAGGGGCAACACGCACTAGCACTGGAGGCAGGATGGGCTTTTCTTC
CTGGGGACGACCGGCAAAGCGCAGTGGCGGCACCTCAGCATCATCGTCAGGGAAATTTGAGTCATCCGGATTGTCCTCGTACTCTCCATCGCCGTCATAC
GCGCTCTCAATCTTCCGAAGTTGTCGTACATCGTCGCGAAGGGCGTTTACTCGTACGAGTGTGACTGAATCTTCTGACCGTGGTGAAGCTTCATCCACTG
AGCTTCTATACCTGCGTCCGTCATGGCGGCTGCCACTTGCGCCGGGTGGAGTGTGACTTGGCGAATGGCTTGATGAGTTATTGTTACCAGAAGACGTGTC
ATCACCGACATCACCGCCGCCTGAGGTGGGGCCTGAGCTGCCGGGTGCCTCCCCCGAAGGTGAGGAGGACGAACTACCGCCACCACCACTGCGTCGAGAG
GACGACTTTTGCGCATCGTGCTGTTCGATACTTGAACCCGTTGCCTGCATGAAAATGTGCTCAAGGCGGTCGATCATTTGCAGCAGCGGCTCATACGTTG
CGAAGGGCTGCTTCATCAGGATCGTGTGCATGAACTTGTTGCGTGTAGCGTATCCCGTCCACTTGTCGTGCTTTTTCAAGATCTGAATGGCACAACGCAG
TAGGCAACCAGACGTGAGTCAAGTTGCTTCAACAACGTCAGGCAGACGGAAACGCTGCCAGGGGGACGAACCGCCTGACTCGACGCAGCGGTCAATATAG
TTAGGATCCGACCTTGGAAATGCCGCAGAAGTTCATCACGGCGAAGTTTTCCAGCAGCAGCAGCTCCTTGTACAGCGCCACGCAGTTTTTCATCAGCGCC
GTTTTGGCTTCCTCGGATTCTGGGTTCGTCTGGACGACATACCGCGAAATTGACAGTTAGACCTCCACGCTAATGTTTATCAAAAAAGAATTCCAGCCCC
ATCAACAGCATTTCTCTTTTCAAATACCTTGAGCTGCTGGAAACTGGCGTCAATGGCTGCCACCTGACTCGTGTGTTTGGCCTGCTCCTTGATGAAGAAA
TCGGCAATCTTCTTGATCTCCACACGCAGCGTCCGGAAGAAGTTCATTTCATCCTGCGACTGGCCTGCTCCAGCAATCAGAACCAATAAGAACCTGTCCA
TCAAAACGACCTCCGCGCGGCACTCACGGATGCTGTCGTTGTCCTCCTTGGCGGACGGTTTGATCTTGATTTTCACGAGCTTGTCGCCCTGCAGCTTCTC
CTCCTTCTTGATCTGCGCGCAGTCCTTGATGATCTTCTTGAGCAGCTTATAGTCGGCCCAAAAGGGCTCCCAGGCCGACGGCGACATCTGCGTCGACTGC
TGCAACACTTTGCCGAACTTCATTTCGACCTCTTCACTCCTAAAACGCAATCGCGGTCTGAGCAGACAAAGCAACTGATAACCAGTCAGCGGGCAGATTT
TGCTCTTCTGCAGAGCGCGGCGGAGCTGGCAACTGGCGGCGAGATTCGATGCAGAAACGAGGAGAAACCACCTGGTCGAATCTTTTCCGTCGCCCGCAGC
AGGAGGAAGAGCCCGAATCTCCAACGCGGACATTGCGCTCTCCCTCCGTCGCTTCGCCACTTCTCACGCAAGCACATCGTGCAGACTTACCTGTGGGCGC
TAGTCGCAAAAGCTGCTATGTATGGCTACGCGGAGCCGATCGGTTATTGTCTTGTGTGCTGCAAAGC