Description :
From Genome Similarity Track
Location :
contig_5:167133- 178100
Transcript NameFunction/comments
g1643.t1KUF88360.1 G patch domain-containing protein 1 [Phytophthora nicotianae
g1644.t1hypothetical protein
g1645.t1RAW34157.1 hypothetical protein PC110_g9517 [Phytophthora cactorum
g1646.t1XP_008897152.1 hypothetical protein PPTG_05368 [Phytophthora parasitica INRA-310
g1647.t1hypothetical protein

Sequence
10967 bases(100 bases per row)
CGACCACACGTGCAAATGGACTCGACGCTCGACCAGCTGCAGCGCACAAGCTCTTTTGCCTCCAGGTGGCTCTGTCGGTCTTCTGTTGCGACTGGCAATC
GGGTGTTCAGCACTTCGCAACCGCCGTCCCACACGCGCCTTTCGGCCATCAGTTCGCCTTCTCATCTGGTTCGCCTGTAGCCATGAGAAAGTCTATGTCG
CTGCCGATCGCGCCGCCTGTCAAGCTGCGCCGCCGCAAGTCGTTGCGGGAGGAGCAAATGAGTCGTTCATTCTCGTTCACCAAGCGCCGCGTCGAGCGGC
AGCCGTCGCGCCTCACACCGATGAAGTCCATGGAGCAGACGCTGCTGGACAACGTGCACGTGGTTCGTCAAGGCCGTGGTGCCCGGCCAGAACAAGCTGG
CCAGCCCGCGCTACGTCATGCGCATCAACAACACCGCGCTGGACCAGACGTGGGAGATGGCGAGGACATTCAAGGAGTTCTACGAGCTCAAGGAGGCGAT
CGTCCGCGTACTCGACTACGGCCACTTCTGTCCTTCAAACTGCCCGTGGCTCTACATGTACGCGGCGCACCACTTCCCGAGGCGCCACATCTTCCGTTCG
CGTAGCCCTTCCGTGATCGCCGGGCGACTCACCGAGCTGCAAACGTATTTTTCGACGCTGCTGCGCATGGCCAAGCAGAACCGCAACCTCGAGTGCGCAG
TGTCATCTACCAAGCTGCCGCAGCTCATCTACGATTTCCTGTTCGAGGGCATGGTTTTCGACCGCTCCGACTTCATGCGGTTGAGCGAGCGTCTCTCGAT
AAATACCCGCGACAGCAGCTTCCTCGACAACGACCCGACACAAGATCCGGAGGAATGCTTCATCTGTCGCAAGGCTCTGGTGGGCGACTCCAGCGTATCG
ATCGTCCCAGCAGCTCCAAGCAGTAACAGGGGGCCTTCGAGCAAGAAACGCGATAAGCACGTGATGGCGGGCCTCACGACTCTCGACTGCGGCCATTGCT
TCCACGACGAGTGCATTCTCGCGAAACTAAACGAGTCGCTGACTTGTCCACTGTGTATAGCGCAAACCAGTCCTCCACAGTCCGGCGTCGCTGCTGCCTA
GTTAACGAACAACCCGTGCACTAGAGACCTCTTAACCTAGCTAGAAGGCTGTGTGTACTTGTTCATAAATGACATGGGAGCCATATTCAAGCGCATCAAA
CCCCATTGCACCGTGGAGATTCATATCACCTCCAAACGATTAAAGTGCAGCAATACCCGCAGCGTGGCTCTTCTCGTCGTTTCGTCTACATGAAGCCCAC
AACGAGACGGCAGTGACTATCTCTTCACGCTCAGGAGAAAGGCTCGGCGGTGTCGTGTTCTGTAGTACTTGTCTGTCTGTGTAAAACCCATTTTATATAT
CCAAAAAACGAATAACCCAATACCAAAATAACCCATTTATAGTAACTTGGGCATGAAGCGTGGGAACGTCCGCAACCAGGAGGTGCGTATCCCTCTCTGT
CTCCCCCTCCTCGCTGTACCGACGGGCTTTTTCTCGGATGCGATAGGTAGTCAAACTCATCGTCTATCACTTCCACCGCTTTTCCGCAGGTTACGGACGA
GCAAGGCCGCCGGCGTTTCCACGGAGCCTTCACGGGCGGCTTCTCTGCTGGATACTACAACTCCGTGGGTAGTGCGGAAGGATGGACGCCACAGACGTTC
TCGTCTTCTCGGAGCAATCGCTCGTCCCAGATCCAGCAGCGGGCTGAGGATTTTATGGACGAGGACGACGACCCGCTGCTGGGCAAACGACTGGAGACCA
CGGAACGCTATGACACGCTGCAAAAGGGAGCCAAACGACAACTGCAACAGCAGCAACAAGTTGGCAAAGCTGGAGCTGAGCTATCCCAGGGTTCGCCTTG
CCGGATGACTGGGTTCTGCCGGTGAACGACTCCGTTGGAGCTAAGTTGTTGAAGCACATGGGGTGGAAAGAAGGTCACGGCATCGGGCAGCGAGTACGCA
GACGCAAGTACGAGGAAATGGAGAAGGAGGGAGTGGAGGGACCGAAACTATTGATGCAAAGTGCTCATGAAGAGAAAACAGAGTCAGAGCCGCAGGATGA
AGAAGAGGTGTACGTTCCGCCACGGAAAGTGTTTGACATTCAAAAGGCTTTTCCCAAGCCCAAGCTGGATCGGTATGGCGCGGGATTTGACCCGTATACG
AACGCTCCCGAGTTTGCGTTCCACAAGCAGCAAAAGGAGGAGAATCAGAGAATGAAGGAGGGGTCTCACCGTCAGGTGGTATCCTTTTCAGACGCTTTGA
AAGCTTCAAATGGCAGCAATCGCGCATCGGGAGGATATGGACTGAGCGCGCTGGAAGAAGACGACGACGTCGATGTTTATGGAACTGTCTCAATGACAGA
ATTTGATCGGGTAATTGCCCCACTTGGAGCGAAGAATGACATTAAGCGGCTGGATTCATCAGCACTACCAGCGCGTCGGTATGAGAAGGCAAGACTCAGT
CGAGCTTTGTGCTCAGATGGACGACCTGTCCTTCCTGGGTTTGAGTTAGCAACGTCGAAGGAAAAGCCTCCGAAGGTAGTTAAATTGCGTCTCACTGTGC
CGTCGGATTTCAAGGCCTTTCATCGCTTTGATGAGGAAGGAGGGCGCGATGATGCCGTAACAGCGTTGTATCGCAAGCATAATTTCTCCTCGGGTAGCGG
TGGAATGGTTGTAACAGCGAACCAACGTGGCGTTCTCCTGGAAGACCAAGGGGAAATGGACGTAGCAATGCTGGCGCGGGAGTTGGTAGCGAGGTGAAGG
GCCCAGCTGCGAGTGTGTTTGACTTGCTTGGCGAGGAGCAGAGGGCGAAACTGTTCGATGCTGCTGCTCAAGCGAAACAGGGGCTACCTTCGTCCAGAGT
TGCACATACTACTTCAGTCAAAGAGTTAGCCGCTCCGAAAGTTCGGCAACCACTTGTGCGTGGTGGTAGTGGTGACGACCAGTTTCGAGCAACGATTTCA
GCGTCGATTGCGAAACGATTCGTTTCGTCAAAAGGTGCAAGCGACGAGGAAAAGAGCAAGCCTGATCCTACTCAAGAGGTTCACACGAAGGCGTCACGCC
GGTCGCAGAGTTTGTGGATCCCCGAATCACTTCTTTGCAAACGTTTCCACGTAAAATGTGCCGGACCGACTGGCTCTGGGGGAAAGATGACGATAGCGAC
AAGAAGCGTGACCTCTTCGACAAGGAGCTCGTTCCCCATTTAGTAGAATTTGCCGCTGACCGAGCTGCTCATCAGCGTCCGCCAGAGAAGGCACGTGAAG
CTTCGAAATCGGGCAAGGTTGCTGAAGATGAACGCGTGCTGCCACCTTTACCTGCAGTAAAACGAACCTCGGCCAGTCTGCTCAAATCGATTTTCGAGCC
GTCGGATGAGTCTGAATTGAGTGACTACGATAGCGAGGATGAAGAAGGCGATGACGGCAATGTAGAAGAGATGGAGAAGCAAGATTCTGCCTCGAGCTTT
CCCATCGGGAGTGCTGAACAACTAGTGCGAAATCATCAGCACGACCAACGTGACGTGAGCTCAGAGTCAAGCTCGTCAGAAGATGAGGTTGGTGCTCACT
CCTCGATGCTTGGCGCTAAAGTTGGCAATAAAGAAGATGACCGAGGCATCAAGCGACTGCGCAGTGAAGATGACACCGACAATGGAGATGCGAGACAAAA
AAAGAAGGACGAGAAGCGGAAGCACAAAAAACACAAGAAACACCACAAGCATCGCTCGTCGCGTGACGACAAGGACAAGAAGAGGAAAAAGGACAAAAAG
GATCGAAAGTCGCACAAGCACCGCTCCTCGAGACACTCCAGGCGAAGCAGAAGTCGAAGTGGGGAACGAAGCTCGGGTCACCGTCGTAGCTCCAGCAAAC
AGCACTAGCAGTAAAGCTGGAACTTCAGTTCTCTACTAACAAGAGTACTTCAGTAATGGAAGGAGTAAACCGACGCTGTTGACACGGCGGCATGGCGATT
ATTTCGCGTGGACTAGCCCAAGCACTTCAACTTGAACACAAAAAACGAACAAAACATTTTTGAGTCTCTATGTAAACAGAATCGATTGAAGCTCAAAGCA
ATGCAAAAACTAATCAATACACGACAGAGGGCTGGCCCCTCTACCGAGTCAAGCACCGTTGCCTGGCGCTTAAAGCGCATGTGTCTCCCTGTGTTCGTAA
TCCTGGCCTATTTGAAAGCTATCCCGCTCACAGCAGCCGCCATTAAATTAGTCGAAGGTCTTCTTGTTGCCCTGGAAGTTCTGGATGGACGACGGCTGGC
GTCTGGGGGGACCATCACCACGGCCACCACGGCCACCGCCGCGACCACCGAAGCCACGGCCACCGCCACGGCCTCCGAAGCCACGGCCACCACCACGGCC
TCCAAAGCCACGACCACCGCCACGGCCACCATCAAATCCGCCGCGGCCTCCACGGCCTCCACCACGGCCGCCAAAACCACCACGGCCACCGCCGCTGTGC
TGCTCGCGGCTCTTGGCGTAGTTGACGCGAATGGCACGGCCGCTCACGTACGAGCCAGCAAGCTTCACAGCCTCGTCGACGGCCTCAGTCGTCTCAAAGT
CAACGTGGCCAAAGCCACGGAACTCGCCAGTCTCACGGTCCGTGGCCAAACGGCAGCTGAGGATTTCACCACACTCGCCGAAGGTTTCACGGATGGTGTT
CTCATCCACGTCCCAGGACAGGTTGCCAATGAAGACGCTCGTGCAGCCCTCCGGCTTCTCGTCGAACATGTTCTTCTTCTCGGCCGTGCGGATTTTCATC
CAGCGGCCTCCAAAGTCTTGGCCGTCCATTGCAAGAGCAGCCTCAGCAGCCTCCGGAGTAGCGAAAGTCACGAAAGCAGTACCCGACGAGCGGCCGTTCT
GCAGAGGGATGCGAGCGCCAGTCACCTCACCGCATCCGGCAAAGTGCTCCGTCACCTCCTCCTCCGTGGCGGACCACGGCAGACCGGCAATGAAGACCTC
AAGGTTTCTTCTGCGGGTTGGCAACAGCAGCGGCCTCGCCGTCCTCCTGCTTGTGGACCTTGTTGGACTTCTCACTAGCGTCCGAGTTCTTACGCTTCTT
GGACACAATAGGGGTCTCCTCCTCGTCCGAGGACGAGTCCGAGTCGCTGGACGACGAAGAAGACTCCTCCTTCTTGGCAGCAGTCTTCTTGGCAGCCGGC
TTCTCAGCCTCGTCATCCGATGAGTCCGAGGACGAGCTGTCGCTGTCCTCCTTCTTAGCGGCAACCTTCTTGGCAGGGGCAGCCTTCTTGGGAGCCTCCT
CCTCATCAGACGAAGAGTCCGAGCTCGAGTCCGAGCTCTCCTTCTTAGCGGCAACCTTCTTGGCCGGGGCGGCCTTCTTGGGGGGCCTCCTCCTCATCAG
AAGAAGAGTCCGAGCTTGAGTCCGAGCTCTCCTTCTTGGCCACCACCTTCTTGGCAGCAGTCTTCTTAGACACCACCTTCTTGGGGGCCTCCTCCTCGTC
GGAGCTCGAGTCGGACGACGAGCTGTCCGAAGCCACGGGCTTCTTGGTAGCGACCTTCTTGGCCACCACCACCTTCTTCTGCGGGGCCTCGTCGCTGCTC
GAGTCAGACGACGAGCTGTCGCTGCTGGACGCAGGCTTCACGGCAACGGGCGTTTTCACCTTCTTGGCCATCGTGTGTAGAGCAATTGGAGAGTCGGGAG
CTGTCGGGGCGTCGAGCGATTGGCAAATGACCAGCGAAACACTCGCACAACAGGCCGTTGGCTGGGATACCTTCAAGCGTCAGCACCGGTTTGGTTGGCT
GCCGCGCTGCATGGTACACTGTGCCGCGTTTCATGTGAGCCACACGAAGTGTGTGGTGCACATGAAGCCAGTTCGTGAGGTTTTTTTCCCTTTCTCCCCG
AGGCTTTATGTGTGGCGGGTGTGGCCCCCCACACAACGACCACACAGTCTTTCTTTCGAAATCCGGCGCGCGAATAAATCCTAATAATGGTGGCAAGTGG
CGACGAGAACGTGGCGGTGGACGTGGCGGTGGACGTGGCGGTGGAGGACGCGACCAAGGTCGAGCACGAGCCGGTGGTGGGTGAGAAGCGCCACGAGCGC
TCCGAGGACATGGACCCGCTCGTCCCGGACGTCGACGTCGACGTCGACGCCGCAGCCTCACAGGACTCGCAAGCGACGCAGGACGACGACATCCAAGACG
TTGTGGCTAATATCAAAGAGGCCACGGCCGTCGACGTGACGTTCGACGCCGCCGCCGCGGCTGCAGCCGTGGTGCCGCCCCCCGAGGTCATGAAGACTGA
CTCGTCCACGCCCGTGCAAGACGCAGTCGCGGCGGCCGCGGCGGCTGGCGTCGGCGTGGACCCGAACGGTGCCGCCAACGTCAAGTTCGACAGCAAGCGC
ATGGCGCGCGTGTCGTTCAACTCGTGGTTCGACTTCGACGCGTACTTTGAACTGTACATGCAGGAGACGTTCCAGCCGTTCCGCATGCGCTCGTCCTGCA
GCGTCGAGGCATACCGCCGCAACCAGCAGAAGGTCATGCTCAACAACAAGAGCTCACGCGGACGCCGCGCCGAGTTCCCGGACGAGGCCATCCACCACCA
CCGGATATACATGTGCACGCACGCCATGAAGGCGCGCTGCCGCGGCGCCAACACGCGTCCTGGGCAAAAATACCGCGGTATCGGCTGCATGGCCAAGATC
AACGTCAAGATCACCCCGGCGGACAACCCGTCCAAGTACATGGTGATCGTGACGGACCAGGTACGAACGGCACCCGATTTGCTTGGTTATTTATTGTGAT
TTGAGATTGACCCGTTGTCTTTTGCTATTGGTGCTGCAGGTTGTGTCGCACAACCACCCGGTGAGCCGCGAGATTTATGAGGCATATCCGGATGTGCTGC
TCAAGATGATGCGGCGCAGCCAGCTGTCCCAGTCGATGCTGGGTCACCCGCCCCCGCCCAAGTTTGAGACGCCTCAGCAGACGCAGAAGTACGAGCGCGC
GATGAATACGTTCCAGTCGATCGCCGAGACCATGGCTCGGCTGGCTGACGAGGACTACGAGCAGCAGCTCGGGCAGCTGCAGCGGCTCTACACCCCCGCC
ACGGAGCAGGATCAAACGGTCTGAGTATGAAGTCGCGAGAGAGGCGAACGGTGGCTATATACCAATACGCGATGAGAAGAGGCTGCCAGCGAGATTCGAT
TTTTGCTCTTGCTGTGTAGCAACGTTCATGTCCAGCATTCATGTGCACGCTAATGCATCGTTGTCACTTCACTGTGGCTCATGGGTACACAAGTTTTACT
ACATCCACAAAATTTGATTACCTTTTTGTGTATGCAATGTGTATCATTTGTGTTTGGTTTGTGTACCGAGGGGGAACTGAGAACAATACACGACATCTGC
ATCGCAGCCTCGTAACCGAAGCAGCGATGGCGAGCAGCGGCGTGGACGTGGCGCTCGCGCCCAACTCGAGCGTGATTCTAGAGCCGGCGGACTCGCTGTC
CTTCCATCTGCAGCCGCAGACGGCGCCCCAGGCGGTATTGACGATCCGCAACGTGGCGGACGACCGGCAGATCGCCTTCAAGGTCAAGACGACGCGGCCG
CTGCGGTACCTGGTGCGGCCCAACCAGGGACTGCTGGGGCCCAACGGCTCGGCCTCCGTCATGGTGATCCTGCAGCAGAAAGACTGTGACGAGCTGCTGC
GACTGGACCCGGCCGAACGCCAACTGGCCAACGACAAGTTCCTCGTGCAGAGCATCTACGTGGACGACAGCTTCTACGAGCTGGTCAAGACCAAGTCCAC
CAAGGAGATGGCGGACGAGCTCACCAACATGTGGGCGCGCACGGACAAGCGCGCGCTGTCCAACAAGAAATTGCGCTGCCGCTTCGTGCAGGACAGCGAA
GAGTTGGGCCGTCCGCCGTCGCCGCCGAGTCCACAGCGAGCGCCGTCGGCCAGCGCCTCGCCGGCCAAGACAGCGACCACGTCGGACATGAGATACCAGA
GTAGACAGAGCGACGAGGTCGGGGACGAGGTGGCCACGCCCGCGCAACTGTCGTCGGCATTGCTGCAGGACGACAAGCCGCAGGCGCCGAAAGTGGCGGA
GAACAGGGAAGGAGGCAAGGAAGCGATCCAAGAAGTTGCGGCACTTCGGAAGAAATACGACGAGGTAGGTGCAGGGTTGAGGTACTGTGGTGACGAGTGG
GGCTAATGGAGGTGCGTTGTGTGCTTGATGGTGCTCAGTTGGTGGCGTTCACAGTGCAGCTTACGGCTCAGCGCGACGTGTTGATGAGCGATCTGGACAA
GACGCGGCAGCTGCTGCAGAAGGCGAGCACGGATGCACAGCGCGTGAAGAAGCTTTCAGAGGAGTCATCGACTTGCGTCATCGGAAGAACAACGGAAACG
GAGCTTCTGGTACGGAGGACTCGCAGGCGATTACGGGAAAGGGTCCCAAGGAACAAGGGGTACGTCTTGGCTCATGTTGATACGATAGGCTATGCTGGCA
ACTGACAGGTTTTGCTGTGACAGGCTTTTGGACCCTTGCACCTGCTGGTGTGCGCGATCATTTTCTTTTTAGTTGGGCGCTACTACTAGGCAACTTGCGT
GCTACGTACGTACGCTGGAGTTAGGCAGAGACAGAAGGTGTTGCTGATGAACGAGGGAGGCAACAGCACGCTTGAAAAAAAAGGAAATTGAAGCAATAGA
GCTTTCTGTCGAGCTGCGTGAAGACGCTGACTCGTGTTCACATGTGTGGAAGTAGGCCGGTAGTGCAACAATCTTGGTTACTTGAAGTAGACGAGAATCA
TATAGTAGGAAGAGTACTACGTAGTAAGTAGACCGATTCCGGACAGGAACCCTTCGGGCCTCTTGGTTCATGGTCAAACTGTCAAAAGTATTCGTGGAAA
CGAGACTTGCAGTGAACTTGATGGTGCATTTGATAGCGGCAGATGGACTACAAGTTACTCGTACAACGCCCTCTTCTTGAATGTCTAGATCTGACGGATT
GACATCGGCAGTGTTGCTGCTATAAAGTCGGGTTGTGCTGATGTGTGGCTAGTTGAGAATTGCTGTGACGCTCATTTTGCGCTTGCCTTCCATGTCTAGC
GGCGCGCAGGCCTTGCGCTTAGCATTCCGAGTGCGGCAACTTTCCGCGGCACTGTCACCGCCGTCGCTGCTGATTCCAGACGCGTGCAAACCAGCGCTGT
CTTTCATAGAAAGCATCGCAATTGCAGCTGCATCGCTGTCCGATTGGGTACCGGCAGGGGCAACACGCACTAGCACTGGAGGCAGGATGGGCTTTTCTTC
CTGGGGACGACCGGCAAAGCGCAGTGGCGGCACCTCAGCATCATCGTCAGGGAAATTTGAGTCATCCGGATTGTCCTCGTACTCTCCATCGCCGTCATAC
GCGCTCTCAATCTTCCGAAGTTGTCGTACATCGTCGCGAAGGGCGTTTACTCGTACGAGTGTGACTGAATCTTCTGACCGTGGTGAAGCTTCATCCACTG
AGCTTCTATACCTGCGTCCGTCATGGCGGCTGCCACTTGCGCCGGGTGGAGTGTGACTTGGCGAATGGCTTGATGAGTTATTGTTACCAGAAGACGTGTC
ATCACCGACATCACCGCCGCCTGAGGTGGGGCCTGAGCTGCCGGGTGCCTCCCCCGAAGGTGAGGAGGACGAACTACCGCCACCACCACTGCGTCGAGAG
GACGACTTTTGCGCATCGTGCTGTTCGATACTTGAACCCGTTGCCTGCATGAAAATGTGCTCAAGGCGGTCGATCATTTGCAGCAGCGGCTCATACGTTG
CGAAGGGCTGCTTCATCAGGATCGTGTGCATGAATTTGTTGCGTGTAGCATATCCCGTCCACTTGTCGTGCTTTTTCAAGATCTGAATGGCACAACGCAG
TAGGCAACCAGACGTGAGTCAAGTTGCTTCAACAACATCAGGCAGACGGAAACGCTGCCAGGGGGACGAACCGCCTGACTCGACGCAGCGGTCAATATAG
TTAGGATCCGACCTTGGAAATGCCGCAGAAGTTCATCACGGCGAAGTTTTCCAGCAGCAGCAGCTCCTTGTACAGCGCCACGCAGTTTTTCATCAGCGCT
GTTTTGGCTTCCTCGGATTCTGGGTTCGTCTGGACGACATACCGCGAAATTGACAGTTAGACCTCCACGCTAATGTTTATCAAAAAAGAATTCCAGCCCC
ATCAACAGCATTTCTCTTTTCAAATACCTTGAGCTGCTGGAAACTGGCGTCAATGGCTGCCACCTGACTCGTGTGTTTGGCCTGCTCCTTGATGAAGAAA
TCGGCAATCTTCTTGATCTCCACACGCAGCGTCCGGAAGAAGTTCATTTCATCCTGCGACTGGCCTGCTCCAGCAATCAGAACCAATAAGAACCTGTCCA
TCAAAACGACCTCCGCGCGGCACTCACGGATGCTGTCGTTGTCCTCCTTGGCGGACGGTTTGATCTTGATTTTCACGAGCTTGTCGCCCTGCAGCTTCTC
CTCCTTCTTGATCTGCGCGCAGTCCTTGATGATCTTCTTGAGCAGCTTATAGTCGGCCCAAAAGGGCTCCCAGGCCGACGGCGACATCTGCGTCGACTGC
TGCAACACTTTGCCGAACTTCATTTCGACCTCTTCACTCCTAAAACGCAATCGCGGTCTGAGCAGACAAAGCAACTGATAACCAGTCAGCGGGCAGATTT
TGCTCTTCTGCAGAGCGCGGCGGAGCTGGCAACTGGCGGCGAGATTCGATGCAGAAACGAGGAGAAACCACCTGGTCGAATCTTTTCCGTCGCCCGCAGC
GGGAGGAAGAGCCCGAATCTCCAACGCGGACATTGCGCTCTCCCTCCGTCGCTTCGCCACTTCTCACGCAAGCACATCGTGCAGACTTACCTGTGGGCGC
TAGTCGCAAAAGCTGCTATGTATGGCTACGCGGAGCCGATCGGTTATTGTCTTGTGTGCTGCAAAGC