Description :
From Genome Similarity Track
Location :
Scaffold_182:16710- 20286
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19762hypothetical protein
Phypa_INRA-310PPTG_19763hypothetical protein
Phypa_INRA-310PPTG_19764hypothetical protein

Sequence
3576 bases(100 bases per row)
GCTGCTCGAGCGTCTGGATGTTGGTCTCCAGCTTGATTTTGAGCTCGTTGTAGTCCTCCGCATCTCGCACTCGCAAATCTTCGATCTCCTGTAAGTACTG
CTCGTCTCGTGTTTGCTTGGCCTCCATATAGACCATCTCCATCTCTCGTCGACGCTCGAATAGCGAGTCAATCTCAAGCTTGTTGTTTGCGATGAGTTCA
TCGCGCTCTTTCATAAAAGCATCTTCCATCTGCTCGAGCTCGAGTTCGTACTCGTCCTGCATCTCTCGATACTGTTGACTCATGCGGTCGACCAGTTTTT
CGACTTCTTCTGCCTGGATCTTAAGTGCCGTCACGTACTCTTCATCCTTGGCCTTCAACTGGTTCTGGAACTCACGGATGACTGCATCTTTCGATGCCAA
GATCTCTGCACACGCGCGATTCTGCAGCTCCAGCTCATTATGAAGCTCCTGTGGCATGCTGAACTCGAACAGATCTGCCCATCGCATCTCAACCGCAGCG
TTCTTGGCGCCGCTGTCGATAGCTTCTTGCTGAAGCTTCTCGACGCGCTTATGACGTCGCTCTTCTTCCTCGACGCGACGTCGATTCTCGGCGTCATCTG
CTTCCACGCGGACGCTCGTGACATGGCGGATACCTGCCAATTTGCGACGGTCGAGCTGGTTCAGACTGTCTGCCACCTGCTGTTGACCACGACTCATGCG
CTGCGACTCGCCCACCTGAAGCTGCTTCTTGCGCGAGGCGTCATCTTTGGAAGCGTTGCGTGCTTCAATGCGCTGTCGACGCACATTCACACGAGCCTCT
CGGTCACTCGCCTCTGCCGACGGGTCTGCGTGCGCCTTGGAAGAGGACGCAGCCGTCGACTCTATCGTCATTGTGCTCAAGAGCTCCAAACTGAGAGTGG
CTTGTAGCCGTTATGAAAACGGCCCTTCAACATCATGTGGTTTACCTAATATATGTACCACACTAGAACGAGCAATAATTGGTATATTCTTTCCATCACA
TTTTCATACAAACTTTGCCCGCGCTGATGGAGCAACCTGCACCGACCAAGAATGGGCAGCACATGCTGTCGCACTTGCTGGCCATCGCGTATCATGTGCT
GGAGGAGACTAAGTACATGAACCTGAGGCCTCCGCTTCGTCCTAGCTCCAAGCTGTTCGCACTCGACGCGCCTGCTCCGGGCTCACCCCCACGCTCCCCC
ACTGAGGCCGATACACCGCAAGATGAGACGCATCCGGACGTCAATGGGCTGGCCGCGGGCTTCGCAGGTGCCGCGCACACGCAAACAGGCAATCAGGGTC
ACCCCATAGTGCTCCCGTACTCGCCCGAGGAGATCCAGGACACGTACACAAAAATTGCGGCGCTCAAAGCTCAGTACATCAAGATCAGCGCCGAGTTGCT
GGAAGCTGTCAAGGAGGTGGAGGCCAAGAAGACGCCGCCGCAGGACGATAAGGTGACAGAAACAGCATAACGCTTGGCGGTTTTCAGACTGACAATTGGT
GATGTTGCTGCAGGACACGATGGCGAAGCTGGTGGCGAGGAGAAATCAGCTGCGCAAGGTGAGGCGATCGCAGTAATTTACTTGAGGTGGTGCCGTGCAA
CTGGTAATATATTGTATGTTGCAGGAGGTGTACGAGAGGAATCTGGTGATGAAAGGGCTTATCGACTGGCTGCGTAATCTGCAGCACTCGATCCGGCTCA
TGAAGGGAGGCACCGCGAACCCGCCCAATATCGTCATGGAGAGCGTCTAGATTGATCAGACTATAGTGACAGTCTTTTTTCTTCAATTTAATCAAAACGC
TATTTATCAGCGTTATTTGTCAGCCATATACTGCAGGGTGTCGTCTGCCAGTGATTTCGAGGAAGGTGAGTTCTCGCTGAAGCGATTGTTGCGAATCACT
GAGCTCTTTGGCGTAGGCTACCAGCTGTGTGACAGCGTGCTGCAGGATACCGTTATCCTTTTCAAGTACTTCAGCGCGCGCTTGGGTCTCAGCCGCCGAA
GTCTGGCACGAATCCAGACAAGTCTCCAACTCTTTGCATTGCCGAACCAAACTGTATAACAAACACAAAGATCAAGCATCAGGCACGTTGAGCGGTTCTA
AACTAGACAACCATGCAGGTAAATGTCACCGTACTCTGTGCGTTGACAACGTTCGACCACCAGATCGCGTTTGAGGTTCCAGTTGGTAGAGATCGCCTGC
TTCTTGCGCTTCTCACTACTACGGAAAGCGCTCACAATGGAATAAAACTGCACAAAGGTTAACCCCACAAATTTGTCACTGTGAACAGGACTGCGAAGAG
TATCACACCTGTTGTCGGGCAATAACTACGCTCGCTTGGAGCTCTCGGTTGCGCTTTCCATACTCCCGCAACGCCCGTCCCAGTGAAACCTCACTGAAGT
CACCGTTAGCTGTCGATTCAAAACCTCAAGTAGTTATCGTCACTGACCGATTCCGGCTGGTCACCATTTGCTTGGTGACGCCCTCCAGCTCGTAGCAGAA
CCGCGTCAACGTGTCCTGAAGAAGTGCGAGCCGCTTCTTGGTTGGAATGAGCACTGAAACAAGCTCACGTTCCGACAGCTCCAATGCTTGCGTGTGTCGT
GTTAAGACTCGATATTCATCGAGAAGCTCGCAGTACTTTTCACCGCGTTGATGCAACAATTGATCTCTTTTCGTGACTTTAAGCTTGGACTGGAGCAAGT
CTTCGACGAGCATCTGAGACGTCTCGAACTGTTGTTGGACTTGTTGATGAAGCTTTTGGCATCTCGCTTGTTCATGCTCCAGGTCTTGTTGCAGCATGAT
ATTACTTTTCAATAAATGTGCCGCATGCCTCTGATTCTCAGCGTGTTCTGCCGTAAATGCTCGTTCTGCCGCAAATTGCCGTTCCTTGAACTGCTGGATC
TGTTGGTTTTGCTGATCGATCAGTCTAGTCTGTTGGTTAAGTTGTATACTTTGCTGCTGAGCAGTGGCCTCAAGATCATTTACGCGCTGTTGCAGCATTT
GAGTTCTTAAGTTATTCCACTCAGAGTCGCTCTTTCGCTCTTGTTGGATAAGACTGTCCTGTAAAGCGGTCTTTTCGCTCTGTGCATCTGCCGCTAGATG
ACGCGTTTGATCAAGTTCTTGTTGCAGTTTCTCTCGTACGATGTCAGCAGCTTTCGCAGCCTTGCTATGTATGCGAATGTCTTCACGCAGTGCTGCTTCA
CCTTCTCGTAATTTAATAAGCTCAGCACTTAGTAAGTCGCTCTTCATGAGAGCTTGTGCCGCCTTCTCAACCGCTTCGTTAACGGCGACTTGAGACGCAG
CGTGTTCACGTGCATGCTGTGCACAGAACGTGTCCATTTCTGATCTCAGCGTCGCCATAGCGTCTCTAAGCCGTGCAGCCTCCTTCTGGTCCTCACTACA
CTGAGCTCGAGCCTTCCGTAGTTTAGCGTCTTTCTTGGCCAACGCCGCTCGCATACGCTCCATCTTCTCGCAGATCTTGGCGTATCGCTCGCTGTCCATA
GGCAGCTCTGAGCCGTTGTCTCGCATGGACAAGACCGAAAAAGCCAATGATGCTACGCTACTCGCGAGGCTGGCGT