Description :
From Genome Similarity Track
Location :
Scaffold_913:1671- 2851
Transcript NameFunction/comments
Phypl_g11607hypothetical protein PHYSODRAFT_320511

Sequence
1180 bases(100 bases per row)
GCACCGACCAGAATGTTGCTGCACTTGAGCGCACCGTGCGGAAGCTTTGCCGTGTGCAAAGCCAGCAATCCCTGTGCGGCTTGCCGAAACATACGCCAAA
GCCGAGTACGGTGTTCTCTCTTTCCAAAGAAATCCCTAAGGTTGCCGCCTGAGGCGTACTCGCAGACGTAGAATTGAGGTCTGTCGACGTGCGAGCCGCC
GAGGAGCTTGAGAATATGCTGATCATCTAGTGTGTACCagaactcgagctgcttgaggaACATGTCGGCAGAATAGCTGTCAATCTCCTTGAAAAGGTGT
TTCACAAACACTTCTCTGCGCTCACCATAGTGCAGCCAAGTTCCTCGCCTCGCTTCGCCAAAGGTGCCTGCTCCAATGACTCGCTCCTCGTACTCCAAGT
CATCCACGGGAATGAACCACTCGGCGGTGGGTAGTCCGGGTAAAATCTTTGTCACTCGATCAAATGTGTCCCTCTTCAGAGCCAACATTTCAGGGGACTG
GTTCTTCCATCTCATCCCGCTCGTAAGCGTCATGAGTGCCTCATGAACCTTCTGGTCTCCACGAAACTCATTGATAAGCATCCGATCTGATGCGCTTGAA
ACCAGCAGCTGAAGTTTCGCGTATTGTTCAGCTCGGTCGTCATGCAACTGGTCAATTTCCTCTGTGCTGCTCACTTCCAACCCCCGCGCCAGGTCATTCA
ACTTcccgtgcagctcgtgaaTCTTGTACACCACGGTCTCACTGTTcgcaaggcgcagcagcagctgcttgcgACGCATCAACTTCACGAACCGAATCAC
CACGTCAGTGTAAACCTGCTTCCTGAggtccttctcgtcgataGGTGCCACCGAATCGTGCAGGTCGTTGAgacgttgcagcagtcgagtACACATGGCC
TCATTCTCCGGCATCCTCTTGCATCGCGGGGCCATGTCCATCAATACTTTCCTACTCGGCGGACTTCCCATCAGTCCTTCAACAGGGAACGCTTGAGCCT
GCGGCTTCGGTAGTGTCTCGGTCTCTtttgaagctgaagctggagctggagcctCCCCACCCGTCGTTTCCGAGTGGATATGCTCGGCATTTGGACACGT
AGCTTCCACCTCCCAGTCCCCCTCATTGAAGACGCTCTTCGCTACCAGTTTGAAGGGGCAAGCAGTGCGACGGAACTTGA