Description :
From Genome Similarity Track
Location :
Scaffold_17:167040- 171936
Transcript NameFunction/comments
Phyin_T30-4PITG_09818Putative uncharacterized protein
Phyin_T30-4PITG_09819Putative uncharacterized protein
Phyin_T30-4PITG_09820Regulator of chromosome condensation (RCC1)-like protein

Sequence
4896 bases(100 bases per row)
CTCGGAACAAGTCGTTCGTCACTACATATCCGCTGTGTAGGCCAGCGTACTGGATCGTGTACGAGTCATCGTAATCCTGCGGTGGCGTGGGGATCAGCAC
CCCTTTGTGCATAAGACGCTCCAGTAACGCAACATCATCAGGGATTTTCGCGGTGGTGAGGACCTCGCCCTGCTCTTCGCGTTCGGCACGCTCTTCGTCG
GACTGCAGCATATAATCGGGGATGAACGCGACTACACGGTGACCAAGCGCTTGAAAATAGTTGACAGCCAGCTCAATCCCAGTACACGAGAAGACTTTGC
CCTTGCCATGACGCATTGCAACATTAGGCGCGTCAATCACGATCAAGTGCTGCTGATCCTTGTTAGCATTCAAAGTGTCTCGGAAGTCAGCATACTCAGC
TCCGATGGACATGATAGTCTTAAAGTCCGGCTCGACTTTTTGTGGTGGTGAATATGAGGAGTCCGACTGGGGAGACGAAGCTGGGGTAGACGAGGCCGAG
GAAATGGGGCGTGTGCCACGAGCGGGTGAAGAACGAGGCGACGCTGAAATCCTTTTCGGACTAAAATCGTAATTGTTGCACGCCAAGTCGTACCCCTGGA
CCCACGAAGGTTGCTGCACTGCATCCTTTCCGTCGTTTGACGTAGCGTCAATGTCGTCTTCGTAACCACAATATTCGCACTCTCCATCTGAAAATGAGCT
GGTATTGCTGCACGAGATGCACAGGCGACCTGCGAGGACAGGATCGATCGCAAGCGGATCCGCTTTCGTAATCGTCTTTGTCGCTTTTGATGGAGTTTTT
AGCCCTGAGTTCTTACAACTGCGTGGCTTGCAAGTATCCCCAGCCTGCACAGAATAAATCGGGGCTGGCGTTTCTCTAGACAACACAAACTTCTCGCTAG
AAGCCATGAATCGCGTTGCACGTAGCACCAGCCGATCCTCTTCCGTCAGTTGTCGAGACACCTTCGTTTCTAGTGTGAGTTCTTCAGGGAATCGAGAGTA
AAGAGCCTTCTTGTAAGGCAAAAATCCGTTCAGCTCGCGATCTTCTGGCAATATGGCGTTGAACAGATTACCTTCACGCTTCTGTGCGCAACACAAGCTG
CGCTCAATGAACCCATTCGCTGACAAGATGCGGGACAACGCCACGCATTCTTCCTGTAGCGCTTTTGAAGACGCGTTTGGCTCGAGCACGAGACCTTGGT
GCAGATGCAGCCAATCCAGGAAAATATTCAGTGCTGGCAATAGAGCATTAGCGAAGTACTTGGTCCGAGTAGATTCCGCTGAAGCAGACAGCACTGCAGT
CAGTTTAGACAACAAACCGCAAGCCGTCACGTGGCCAACTGCCAGCGCCTTCTTGGTCAATTCACTCTTACTCAATCTTTGAAAGGCGTCGTCGAGCGTT
TGGCGACTCGTTTTCCCAACGTTGTTGTGAGCGAGCACGATTGACAAGCACACAGTTCGAGTCAGCATCCTGGATAATGCCTCTAACAGAGGACCATCAA
TCGGCATCGTCTCGTCTTCTTCATCGCAGGCATTCAGTAGCTGAATAAGCGCAGATTGCTTACGTTCCAAGGCTGCGTCCCACTCCTTCTTGCCACCTTC
TCCAATCTGAAACATATGAAGACACGAAAGCACACGTGTCGAGTAGGTCTCCATCGCCTCACAAGTATTATAAGAACCTCCTGGTGTCTCTTGTTGGACT
TGAAGCTGCTTCCCTGCATCCCTCCCACGCTGCAGCACATGAAGTAAGTTGCCACTAGTGGCAAAAGGATTCGCGCACGTGAGACTACGAGCGTACAGGT
AAGCTCCATTCAGCAGTTTTCCTTCAAGCACTGCGAGCAATCCTAGTTGATTGTACACCTTGCCGTTGGACGGGGCCACTTCCAAGGCCTGCTGGTAATA
TGTCCGAGCCTCGCTCCAGTCCCGACGTTCTTTCCCAAATTGGTTCTGCTCGTATCTCGCCACATCTCCAAGAGCAATTAGCGACTGCTGTAACGAGTGC
TTTAACCCATCTAGATGTTCCGGCTGGCGGCCACGTGTTCGCAATGAGCTCTGTAGGCCGTCCATAAGACTCGAGTAAAACGCCGAGCAAGCTTTCAACA
CCAACAACGACTGGCCCTCAATGTCACGGTACCAGCTTCTCCACAGCTTCTCGTTGATGTTCTGCACAAACTGATCGTCAGTTTACCGTATAATATCAAC
AACTGAAATAAACCTGTACTGACCAGCTTCTTGGTCGTCTTCGGGTATGCATAAATTAATTCCACGCATGTACGTCGCAAACCCGAGTGCGCTGACTCTA
CTGCGCTCTGTTCTTGACTGTGATATCATCGTTACGTAAGTAAATCGTTGTAGAAAAAAACTTATTGTTCTCTTATCACTTGCCCGCTAGTCTTGAGCAG
TATTTCGCACGTATTGAGCCTCTGCAGCAGCACCGAAGCGTCCTCCACAGGAACGCGAAGAGCCTCTGGTACTGGAGATGGCAGCGTTGGCGGCGTTTTC
CTGCTGGCCGCCTTGGGGCGGTATAGCGACTTGCGTGGTTTGGGGCTCTTCTTCCTGTTGTCTGAGAACGGCGTTATCATTGCCGCCACCAGTAACGGCG
GCGCGTTGGGACTCGAGCTCGCGGCGCGCAGCGGCCGCTGCTTTTGCTGAAATAGCGCCATGTTTCAGACTGTTTCCTTCTACATGGAACTGTTCCATCG
AAATGGTACAATATTTTTTGTGTGTGTTTGTGGTGTATTAAACACACAACTTCTTTTTGGCCTCCCTCGATGGATCGCAGCAGATCCCGACGCAGCGCGA
GTCGCTCTCCGCGCCGCCGCAGACGTCGTAGTAGCCGCAGTCCGAGTCGCAGCAGAAGTCGCAGTATCGTAGACCGAGCATCGCTCAATTGGGGGGCTAG
AAAGGGGTGGGTCAATACCGATCAAAGCGGAGACCGTTACCAGCCGCGACGTAGGAGCCCCAGCGCCAGTCACGAGCGTCGTCTGTACCGAAGAGAACGA
GAAGTGAGCAGTAGCGGAAGAAGCTACACGAGTAGACGCAGCAGAAGCCGCAGCCTCGACATAAATCGAAGTCAAGACGTCAGTCGCTGGGACTCGAGTC
ATCGACGCAGCCCCAGTCCACGTCGAAGACTTTATCATACACGCCAGCGCAGCCCCAGTCTACAACGCCAAAGCCCCAGCCCACGCAGATACAAGAAATA
CGTATCGTGTCATCGGAGTCGAAGCCCTCGACGAAGCTCAAGTCCGCGCAGACAGTGTCCATCTCCGCATCGCCGTAGCTCAAGTCCAAGGCGCCAGTAC
AGTCCGAGCCCTCATCGGCGTAGCCTTAGTCTGCGGAACAGCAGTTTTAGTCCACAAGACCGTAGTGCAAGCCCTCGCCGTCGGCGCAGTCGTAGCCGTA
GCCTACGTCGCGACCGGGCAAGCAGATCGCGGTCGGATTCCCGTTGGCGCCGAAGTGAAGATGAAGCTTCGCGATCTGGGTCATCGCGTGGCCCTAGTAG
CAGCCGCTACAACGACACGCGGGCTATGAACCCGTTAGAAACTAAACCGTCTCTGACGCTGTCAGCGGGTAGTCCCCCTGCGGCAAAACCTATTGATCCC
TCCGATAAGAAGCACGACGTGCGGCGCGCTGTGAAGGAGTCTGCTAAGCTTGAAGATAAGAGCTTCGACGAGCCGCCCCACTTATCCGCCACTGGCAGTC
ATGATGACTACGGTAGCTCCCTTGGCTACAACCACCTGCACTTGCAGAGCCGTCGTCCTTTCCCAGATGCCCGCGCGCCTTCGTCTTCACCAGCAGCACC
TCATGAGTCGTCAACGCCACCGAAATCAGTCACAATATTGGATCGAGTGACTGTTTCGTCTCCACGCGGTGGCCACAGTAGCGCGCTGACCCCCACGATG
CCATCCGATGGCAATGGAAATCACCTCGTTGCTGTGAACCCTGTCCTGGAGAAGATGCGGGAGGCCCAACGCGAAAGCCATCGTGCCTACTTGAAGGGCA
ACAGCGATTACAATCGTGCCGAGATGAAGTCCGTGTCGATTGAAGGTGAGCTCCGATTGGCCGAGTTCTGGCTCAAGGTCGTGACGAAAAACCTGGAGGA
TGTGGGTAAGCGCATCGAGGTGCACGACTGGAACTTCCAAAAGATTGCCAACCAGGACGGAGTAAGAAGAACTTAGGACACGAAGAAGGGCAATGCTGGT
TTTTTCAAGTAATAATGATAGCTGTTTTTGTTTTTTGTTTACCGGTACATTAAGAGGAGTGGCGAACATTCAACAGCATGACACCAAAAGTGGCGGCCGT
GAGCCGTGAGCAGTTTGTCGTCTACTTGTCCTTCTACCGATTCTGCAAGACTTCCAGGATGAGATCACGGGACAGGCTGGCAAAACCATCGGATTTTGTG
ACCATGTCGAAGTTCTGCACCATGTATGACAGGCAGATCTCACGCAGTCGGTACGAATGAAGGTCATTGGCAGACTGGAAGAGCACGGCTGCATTCTCAA
CGTTGATGTTCTTCTGCACGATAATCTCGCAGAGGCCCTTGAGGCGGTCCAATGTGTACAGATCGGCGGCGGCGTACAGCTCCAATGCCATCTCAGCACC
CACATTGATCGAGTCCACATAAATATACTCCAGTAGTGCGAGGAAAACTGGCACCCGAGTATGTGACAACGGGATCTCCTGTTCGTGAGATTCACGCATG
CCTGACGAGAACATGGCACGAAAATGGTCACTGCGAGCAGCCAAAATAGCGCGATGGGAATGTACCGCGCGACCTTCGATGAGAAAAGTCACGTCTGAGA
ACTCAGCGCTGTCAATAAGCTGGCGCATGTCGCCTACATACGACGACGTCAGCATGGAAGCACGTAGCATCGCCACGGGGTCCACCAATGCGACTG