Description :
From Genome Similarity Track
Location :
Scaffold_2761:167- 2606
Transcript NameFunction/comments
Phyta_totarag14809hypothetical protein

Sequence
2439 bases(100 bases per row)
AGAGCTTTGGGGGTTTGCGAAAAGTGAACTACCTCGGAGATCAAGTATCGATCGAGGGTTTGGAGGCTCACCCGAAGGACCTGTCGTCGTTGGTTGATCT
ACCGTTCCTTACGACATTAAGATCGATGCAGTCTTTCTTGGGCAGCCTCAACTATTACAGCCGCTTCATTGAAGACCTAACGATCTACGCGTCAACCTTA
TATGAACTCCGGGAGGCCGACTTTTACGAAATCTCGAGGAAATCCAAGCGTGATCTGAAGGCGCCAAGGCGCCATCTGGGTATCAAAGATGAAGATCAAC
CCAAAGAAGCCGGAAAATGGAACCGGGCGGATGTGGCATTGGCTACCCTGAAGAATAAAATCGCTACAGCACCCATCCTACAACACTTCGACCCAGATCG
ACGACCGGTGATTATAGTCTACGCGAGTAAGTGGGCGATCTCGGTAGCTTTGATGCAGGAGCATGACGGGACGGACAAGCCTGTGACATTCACCAGTCGT
CCGTTGAAGCCTAACGAGATCAATTACGGTATTGTGGACAAATgagtgctggcgctgctcagGATGCAGGATTCCTGTTATACCCAACTGGTGACCCGAC
CCATCAAGGTGTTAACTCGATATTCCACGTTGGTCTGGCTGGTTCACTCATCGGGCTTGCAGGGACGCTTGGGCAGGTGGGCCGCAATTCTTTCTAGCTG
GACGTTGGAGGTCGTCAAGTGCACGAAGGGCGAGGATGAAATTTTGGGTGTGATAGCGGCAAGCATTTCTCCccgagaagaagttgacgcgATCTTGACG
TCGATCGCACCGCGAATAGAACCTCGTCAAGTGATATCGATGCCCCCTCCCACGGTGGAACCCGAAGCAAAACTGCTTGTAGTAAGTTTCGACGGATCga
gcgaggtggaggagcgTATGGAGCAATTGTGTGGAGTCTACCAGAATGGACAGTGATCTCTGCCGCGTCTCAGTACAATGTCGATCTTACCGTAAATGAG
GCGGAGTACCATGATTTGCTCCTGTGTTTCGATCTCCTGTCCCACTTGGACAGGGGACGGCTGATTATATGTGGAGATTCAATTTGGTGATTCGACAAAT
GCGCAGCGAAATCGAGTGTAAAGCACCAGGGCTCAGATAGTTGCGTAACAGAGCGATGGAACGTCTGCGATCTTGGCCGCGCCACGAGTTCCTCTACATG
AAGAGAGACTGGAACCAAAGTACCGACCGAATAGCCGGTGCGGCGCTCCAACGTGAAGGGAGTGACGTAGTTACGACTGAGATCGAGCGCCAAGATTTGA
GGACACTAAATCGACTGAGCGAATTGCTGGTTCCACAAACGAGGAATTCTACCGTGAAGATCTCGGCTGTAACCAGATCACGCAAGCGACGCAGCCCTGA
AGTCCTGATTGAGGAGATCGTCCAGCAGTTGAGGGCCGAACGTGTTCTTCGAGCGCGGAACGAAGAAAAGTGGATTGGCGATCTCAAAAAGTACCTGCAA
GGGGACGTATAAGATCTCAGCTCGGCAGAAGCAAAAACCTGCGCCAAGATCGCGGAATATtatgagatcgacgaggatGGTTTGCTTTTCTACTGCCCGC
CATCAACGCAGCCGCGTGAAGATCGTGATCTTATCGCTCTATTGGTCGTCCCGGAGACCCTGCAGAAGGAGTTCCTGCACCATTACCACGTCAGCTTGGA
ATGAGGACATCAAGGAGTCGGACGGACTTACCAGCGACTGCGAGCACATTCTCACTGGAGAGGAATATCTCAGAGCGTGCAGCAATATGTGAGGCGATGT
GGGGATTGTGAGACGGGGAAGAGAAGACCTGTTATCCTAGGCGAATCACCGGGTAATTTACAGGCGACCTACCCGTTTCAGATCATCGCGATGAATCACA
TCCCATCGTTACCTCGATCTCATAAGGGCAACGCTGAGTTGCTGATCTGGGTCGACCTCTTCACCGTATTTGTGATCGCCAAAGCTAGCGCCTCCAGGAC
GGCACAAACAATTGCGGGGAACTATGAAGAGTGCGTTTTCCGGTGTTTTCGGTGCGAGTGAAGCAATCCGCCATGACCGAGAACCCGGGTTTATGTCGGA
CTTCTTTAGATCGTTCAATAAGATCGTCGGCCAAAAACAGCTCGCAACGATGGCGTACCGCCCACAAGCCAACGAGACGGCCGAACGGATGGTGCAGACA
CTAACCCAGTCGTTAAAGATGTACGTCGTAGACGTAGACCAGAAGGACTGGGATGAGTTAGCAGAACGCCTGAcgttcgccatcaacaccgctcaagatc
gagtgCGTGGAGATACACCCTTCTATCTGGTTCATGGCTGGGACCCGCGATCTACACTAGAAGCGATGATACCACTGGGATCGACGCGTCGCCGAGATCG
TGGCCCATAAAGATGGTGATACCACATCCAGAGACACTA