Description :
From Genome Similarity Track
Location :
Scaffold_124:167- 2443
Transcript NameFunction/comments
Phyta_totarag4090hypothetical protein PHYSODRAFT_476077

Sequence
2276 bases(100 bases per row)
TGGGTTCGGTGTCGGGATCACGAGCTCCACACTTGTTCTCGCTACCGGCGGTACTGACCGTACTGGTGTCGTGATGACGGGCTGCACActcgttctcgct
gcagGTGGAACTGaccgtgctggtgtcgtgaTGACGGGCTGCACGGGATCGAGACTACATGCAACATTGCTGATCTTGCTGGCGAGACGGCTAAGATACC
TATCGGGGCGGCACCACTGTAAAAGCACGGCGGAAAATCCCTCAGAGCCTTACCATATATACGTTTAAGGCTCGTTAGACGCAACCGCAGCTCGCGACTG
GTGCGCTTGGACCTTGACATTCGCCTCGACACGTAGTCCCATGTGACGCGGAGTCCCTCGCGTTCGAATTGGAACGCGATCTGGACAAGTTGTTTGTCTT
CCCAGTCTTGGAACGTTGTGCGCATCTACACGGCAAATGAGTGTATTGATCTTCCGTTTTGTATAGCTGGATAATGAGTCGATGTATGCATACATCTTGC
TATTTGTATAGATGATAGTGGGTGGCAGCAAAAGAAGAACCAGTAAGATTTGAGGACCCGGGTGGTGGACAGTAGGGGAATTGCATGAGCATGAGAGATC
TATTACAGTCACATTTCTTGTAAGACTGGTAATTTCTGCTCTGTTAGAGCATGTACTAAAATACCCGTAGCTATGCAAGGTGCTGCATTCTCTTCATATA
TCTTCTTATCCTGCACAGGTGCGGCTGCTTCCTTATCGTAGCTTTATCTGTGTGATCCAGCCcatgcgctgctgctttatCTTCTTCGCTCTCATCCGGC
ATCTCACCGAGTCATCAGCAACTTGCCCGTGGGGCTGCTGTTTTGCCTTCTTAGCCCCCGTCTGGAACACGACGCATCTCGCCCAGCCGTCAACAGCGGT
CGATCCCTTCTCAGATCGCTCCCCAAAAAAACTATATGATAGGTGGCTGGCAAACGGCGATTGGATAGCTCTCGTACTGCTCGCGACGTGGCAATACGTT
TTGTGCTAGAAAAAAAACAGCCCGGATTTTTCCTTACAGACTGTGAAGCAAGTAAAATACACCTATCCCGTTAGGAGCAATGattttgattggttgaaac
AAAACGGGGTAGATGGAAAGCGCATAAAATGCGCTGCTCTTGTACAAGGGCGCAttttgcgcccttttagagGGTGTTTTTCTACCGTGTTTTGGAAACC
ATCTAAAAGGGCGAGATTTGCCCCCTTTTAccacgaaagggttaataaaAAGgcaagtccagcaccacacaTCGGCACCGCCTTTCACTAGATATTCTAA
ACCACGTTCCAGGGGAGTAGGCAGACATGTCCTGCAAGTACTGACAGTGTTCGGAAACGACTTCCCAGCTGCAGACACGCGTGTGGCCATTGCCTTCTCA
AATGCGCACGCTGATGCCTTCTGTCAATGGCGCCCAGCCCAGTTCACCTTCAGACAGCGAAAATGACTGACCGCCCCGCATTGATCGTCCAACACCAACG
ACTGCAGTATCGTGAATCCAGAGGCGGCAGCAAGACCTGATGCGTCAATAGTAGGACAGGCACCAGCTAGCAGCGTCCTGTTTCTtatctgttgctgctc
aagacaGCAAGAGCTTTGCTCTCAGTCATTCCTCAATTTACCGTCGACCAGCAACAGTTGCAGCCTTCCCATTCAGCACACGACGCAACCATGCAACGCA
CTTGGTCCGCCGCTCTCGCTACTGTCGCCACGGCTGCACTTGCCTTCAACTCCGCCGGTGCTCACGGATACATTTCCAAGCCGGCTGCCCAATTCGTTGA
CTCGTCCACCTTGACCAAATACGCCAAGACCATTACAGCCGACGTCAACAGCGCCTTTGGAGGTCTCAAGTGGGACGACAGTCCGGAAGCGAAcaccgcc
accttcacctcgTCCTTCACCAATGCGGGATATTCGTCACTGAGAGACATGCTCGACCGGCAAGTCACGGACTGCGCCAACACTCGCACGGACTTTTCAC
CCGTTGATGTCTCCGGGCTCACCGTCATGAACTGGCAAAACGACCAGGAACAGAAAGGATTCATTGACTCGCACCATGGCCCATGCGAGGTCTGGATTGA
CGATACCATGGTGGACCACCAGGACGACTGCGTCGCGAAGTACGGCTCCGGGTACCCTGCCAACGTGAATGCCGACTTCTCCAAGTGTTCGGGCGACTGC
ACTCTGCGCTTCTACtggctggcgctgcacgagccCAACTGGCAGATCTACAAGCAGTGTGTGCCCGTCGTGAACA