Description :
From Genome Similarity Track
Location :
Scaffold_5:166973- 172491
Transcript NameFunction/comments
Phyci_89632conserved hypothetical protein
Phyci_89633conserved hypothetical protein
Phyci_89634hypothetical protein
Phyci_487618Hypothetical protein

Sequence
5518 bases(100 bases per row)
ACGCGCCAAGGTGCGCCCGGGGAGGTGAACGGGAATGAGGAGGTTTGGATCACCGGACTGATCTATGTGTGGGGTTGCCTTCGTTTATTTTGCTTGTGGT
TGGCAGAGCACATGGATGGCGTGAAGACGTCGCTGGATCGATTGCAGATGCTGCTGAATCTCATCCGCAACGAGCAGGACTACTACCGTGCGCGTGTGCA
CCGCCACGTTCAGAGTATGTTTCAGAGTATGTTGATACAGAGACTAGCAACACTGACTAACGACTTGTTCCGTTATCTTTGTGTGTGCTTTTTTCTTGTC
GCGTTAAAGCGCTCGAGAGCAGCAAGTCGCGCCTCATGTACTACACCATGTTCGAACTGCTTGTGCTGGGTGCCATGTACGGCGCGCAGTCCTTCTTGCT
GCACAAGTGGTTTAGTGATCGTGGCTACCTCTCCAAGCGCCAGTGGGCGTAAACTACATACAATGAAGGATTGACTGCATGGAAGCAGGCAATGTGCTTG
TACCTATAGCAGTCGATGAAAGGGAGGGAGTGCGAACTAGCTAATCAAAAGAGCCACTGAGACCTAGTGGCCATAGAGATTCCCAACACCAAATTACTTT
TTGAATCATACCTCGCTTTCTTGCATCATTACTCTGCTGTTGCTCAAAGGGCCTCCGAGTTCAGTTAATAATCCTCGTCTGAGCTCTTGCTCTCTATCTC
CATCTCGTCCATAATCTCTTGGCATTGACGTCGACGCGCTTCAATAGTAGCGGCACTTCCTGCCGCTGACACCGTCACCGGGAATGCAGCTCTACCAGGA
ACATCCTCCTTCACCGACAGATAGAACACTGTGCCGTCGTTACTCGGGGTCGCTGGAGTAAACCGATATCTGCCTTTGTCGTCAGTCAGGATGCCTCGGA
TCGGACTGAGATCCAGAAGCTCCCTCACGCGAGTCAACAGGAACCTGTCCGACGTGATCGCCACCTCTGATGGATCCGGGGAACCCCCTTCCTCCTCCCT
TCGCAATGCTCGGAATGTGCCTTGCTGGAAGAAAAACACGCGGAACGTCGAGCGCTTCGTGAGTGGCTGCTGGGTCCCGGGACTGATGCACTCCAGCTCA
ATGAAGCCCGCGACGGGGCCCACCACGCCATGAATTGGCGCCTGCAGCCGGATTCGGTCTCCCGCAGGAAGCGATTCGAGCGTCGTGGAGAAGAAAATGT
CCTCGGAGTTGTTCATCCGCGCACTGACCTTGGTCTGCCCCAACATGATCTGCGAGCGATTCACCACCTCAATTACCAGTCCGTCATGGACGTCGTAGCC
CGAGTAAATGGAGAGGCTCTGCAGCATCGCCGACTCCATCACTTCGTTCATCATACGCATCACCTGCGCGCTCTGCGTTAAGCTCTGCCCCACGCGCTCG
AATACCGACTCGAACGACTGCTGCAGCCCGCCAGCGTAGCTCTCGAGCATTCGAGCCATGTCGTCCATGGTCTCTTCGAAACAATAATAATTATTGTTTT
GAAGGGACCATGGACGAAACAATAATTTTTATTGTTTCGAAGGGACAATAGACGACATGACAATTATTGTTTATTATTGGCGCAATTACAGGTATAGACA
TGGCTCCACAAGGTGTACTGGTTGCCTTCAAAGCAACCAAGTGATGCTAGACGTCCAGTTTCATGCGAGTATATTCTAGTCAACCGACTCATCCTTCGTT
GCAATAAATTACGATTGGGTTCTAATGATGAGGAAGTCACTTGGCGTTCAACTACTTGATGTACGTGCGTCTGGCAGCCTCGGTAGACAACTTGATGACT
TATCTGCGGCCGAAGCCGCCGCGGTTGCCACCACCACGGCCACCACCACGGCCTCCAGTCAAGTTGCCGCTGTTGTCGCGAGTGTACGGCGACGGCTCGA
TGCCAGGCACGCCAAGGAGGTTCATCTTCTTCAGCGTCTTCTTCTCGAGCTTCGGCACCTCGTCCAGACCGATGATGCTGCTGTAGTCGGCCGCCAGGCG
GACTAGCTGCTCAGGCTTTAGCTTCAGCCGCTTCGAGTTCGAGTTGTAGAAACCAAGCCACGCCTGATACGACTGCTGGGCCGACTTCTCCACCTCGGAG
TAGCGCTTCAGGTTCTTCACAACCCCCAGCGCGCGCGACTGCGACGGCTCCAGCATCTTAGGGGTGTGCTTCTTGCTCGGCTCAAGAGGCAGGTCGGTCA
GCTTGTCCAGCAGAGGCGTCTCGAACTCAGCAAGAACGAGAACACCCTTGCCCTTCATACCAGCGCGGGCCGTACGTCCAAGGCGATGGATGTACTGGTC
GCGGTCGGTGAGGCCAACCTGCAGGACTAGGGAGACATCCGGGTAGTCCACACCGCGAGCCGACACATCCGACGAGAACATGATAACCTTGTGGCCCTTG
CGGAAGGCCTCTGCTGTCTTCGTGCGCACTGCCTGACTCTTACGCGAGTGGATCTCCAGGACACCAGGAAAGCCCGCAGCCTGGAAAAGCTGTGCCATGA
ACTGCGCGGAGCGAGCCGTGGGGAAGAACAGCATCACCTTGTACGCCGGCAGCTTCATGTGGGCAGTCAGGATACGCTCCACCATCGGGATCACCTCTTC
CATCGTGCACACTACGTACTCCTGCTCGGTCTGCACATTCGTATCGGCTTCGTTCTCATCAATCGTGTCCACGAACGAGTAGTCCTTGCGCAACGCGACC
TGCTTCAGCTCCTCCGTGGAGGCCGGCAGCGTGGCGCTGAACAGCAGCGTCTGACGCTCCTTCGGCAGGTATCCGATAATGCGCATGACGTCGGGGCGAA
AACCCATGTCCAACAGGCGGTCAGCTTCGTCCAGAATCAACACGCTCGACTTGCCCAGTCGGTCGGCAATCCTGCCGGTGTTCTGCTTCAAGTGGTCAAC
AAGACGTCCAGGCGTGGCAACGAGGATGTCGATCGGGTCGCTGCTGGTGAGCGCGCGCTCGTCCTTCTTGATGTTGGCACCGCCCACGAAGCACGCGACC
TTGAGGTCGTGGAACTTGGTGAGGCGCTTGGCCTCCGTCGCGATCTGCTGCGCCAACTCGCGCGTGGGGGAGATGGCCAGCGTCGGGATGACGCCCGAGC
GACGTCCCTCCTTCACCATGTTCTCGATCACGGGCAGCAGGAAGGCGATGGTCTTGCCGTTGCCCGTCTTGGCCTTGGCCAGCACGTCCTTGCCCTCCAG
GATGAGCGGGAACGTCTCGTTCTGCACGTTGGTGAGGCGCTCGTACTTGAGGTCCTCCACGATGGCGCGCTTGGTCTTGGCCGAAATGTCCAGCGACGCG
AACAGGACGTCCGACAGGTAGTCCAGGTTGGTGGGCTTGGAGGCCTGCACGGGCGCCGCCTCCTGCTTCACGGGGGAGGCAGCGACGGGCGCAGGCGGCG
CGGCGGTCTGTCCGTTAGCCTGGCCATTGGCGCTGGCGTTGGCGTTCTTGTTGTTGCGGCGACCGCCGCGGCGCGGCTTCTTCTTCGCGTGCTCGGCGTC
GCTGTCCTTGCGGTCAGTGGCGGGCGTCTTGCGGCGCCAGTTGTTGCTGCTGCTGGTGTTGTTGGAGTCCTGGCGCGGCATGTTCTTCTGCTCTGGGCGG
TGGCTTACTGGCTTGACTTGGGTGGCCGCGTGCGTGGCAGGATGGGAATGCTGGACTGTCCGGCGCTATCTTCAGAAGTTAAACGCCGCGGCCACCAATG
GAGACGAAACCACTTGGCGTTTGTATGCCCCTCGATAACTACGATATTGCATATTGCAACCGTTTCTTTCCATAGATTTGGCAAGATCTCCGATCTTCAT
GCGCTACTGAAGTTTCTTTAAACGCAATTATAAATTTTATTTTGACAATTCCTGACAAGCGCTCAAGAAGCAGCAACGCGGAGGCCATGTCGACGCTCGC
GGATTCGTTCCTGGAGGACCTGGACGAGCTCAGCGGGGGCAGCAGCGACGAGGAGGAGACGCAGAACATCTCGTCCGAGCTTGGCGCCGTTTCGGCCGCC
GATACAGAGGCAGGAGACGATGAGGACGACGATGACGGCGACGCGCAGATGCCCGAGGCCTCCGCCGCCAGCCAGTCCCGAACCCCCCAGCGCAAGCGCC
CCGACGCAGAGCTGGAGCTCACGGAGGAGAAGACCGAGGACCTCGCAGTGTCGCTGCGCTCCAACGTGAAGCAGCGCGGCGTGGCGGCCGTCGCGTCGCT
CAAGCGCTCGCCCAAGTACTTGGCGCACGTGCAGAAGATCCAGCAGTTCGTCGACGCGGACGACGCTGCCGCAGCCTCCTCTGCCAAGCCTCAGCCGCTG
GAGGAAGGCAGCGCCGAGTACGACCTGGTGGTCACGTCCAACGACCTGATGGTGCAGATCGACGACGAGATCGAGGCCGTGCACCGCTTCATCGCCGAGA
TCTACGCGGCCAAGTTCCCGGAGCTGGACTCCCTGGTGCCAAATGCTCTGGACTACGCCCTCGTGGTGAAAGCCATTGGCAACGAGATGGATTTGACTGT
GGTGGAAGAGCTACCCAGACTGCTGCCCAGCTCGGCTGTCATTGGAATTTCAGTGACGGGATCGGGTACTAGTGGTAAACCGTTGGAGCCCGAGGACTTG
AAGACATGCATGGAAGGTTGCGATGAGTTGCTGTCGCTGGATAAGGATAAGAGCATGATCCTGCGCTTCGTGGAGAGCCGCATGAAGTACCTGGCGCCGA
ACGTGTCGCAGCTGGTGGGAACGCGCATTGCGGCGCAACTCATTGGACTAGCTGGGGGCGTGGCGCAACTTGCACGTATCCCGTCGTGCAATTTACAAGT
ATTGGGACAGGAGAAGAAGGTGCTAAGTGGGTTTTCTTCGGCTGCGGCGCTGAAACATACTGGTGTTCTGTTCTTCAGTGACCTCGTGCAGAGTGTGCCG
CCATACTTGCGGATGAAAGCGTGCCGGGCTGTAGCTGGGAAGCTAGCGCTGATGGCGCGCGTCGACAGTCAGCCACACCAAAATGACACGGAGGGTCTAG
TCGGCGCGCGGTTCCGCACGGAGCTAGTTGGGAAGATGGAAAAATGGCAAGAGCCGCAGAAGGCTAAGACTAAGAAGGCACTGCCTATTCCGGATGAGAA
GCCGCGCCGCAAACGTGGTGGTAAGCGCTACCGCAAGATGAAGGAGCGGCTGCAAATGACGGATGTGCGCCGTGAAATGAACCGACAATCTTTTGCGACC
GCCGACGAAGAGTATGGAGACAACGCCATGGGAATTACCACCGGCCGTCTTGGTCAAGAAGGATCAGGCAATTTGCGTATTATGCGTAAGGAACAGAAAC
AATCGAGCAAGAAGTTGCGCGCTGCAAACTTTGCTGCATCTTCGGCTAGCAAGCCGCCACTTTCTGGGTTGGCATCAAGTCTCGCCTTCACGCCTGTGCA
AGGTATTGAGCTCATGAATCCTGAAGCTGCGAAAGCTCGTGTTGCCGAGGCAAACAAGAAGTATTTTTCAGCTGCAAGTGGATTCGTCAGTGTCGTCAAG
AAGCCATAAGAAACATAC