Description :
From Genome Similarity Track
Location :
Scaffold_25:166944- 169599
Transcript NameFunction/comments
Phyra_94824HECT E3 ubiquitin ligase, putative
Phyra_77527Hypothetical protein

Sequence
2655 bases(100 bases per row)
AACAGTGCCAAGCGCAAAACCTGCCTCATGTGCGGCACCAGCATCGGGTTCCTCATGAGCACGGAGCTCGGACGCCGGAAGAGCTCGCGGATGCTGCTAC
GCAACAACAGTCGAGGCATCACGGGCGCCGACGTGGCCGGTGGGGCAGGAGAAGAGGAGGATATGGAGGCGTTGAGGGTGAGGCAACGCGCGCTCTTTAA
GCGCCGGATGAACACCATGGCGGCCAGGAAGAGCTTGTCGCAAAGACAGCGCGGTGCGTTCCGACGACGCCTTTGGCAACGCAAGCAGTTGTCCGATGGC
AAGTTCCATTGGGTCCGGCAAAATAGTACGGATGCGGTTGACCCGCTACCGGAGCTGCAGGGTGGAGATTCAGCGCAGGCGACGCTACCGTCGACGGCGG
AAGCGACGAGTTTAGCGGGGCCCAACGGAGAGAGCGTCACAGACTACCATAACCTGCGCTCGCAAGGCTTTGTGTCGATGTACGACGCTACGGGGCGGCT
GACGTGGACCAAAGCCGATGAAGTGTCGATTGACATGGAATCGTTTGGGAAGGGGCTTGACAATATTGACTTTGAGGTGGGCAATTGTGGCGATTCGTGC
ACGTGTGTACTTGCTTGAGGTGTTCACGGTTGTGCTTGTTTGACTGTAGGGAGTGATGGCACTAAGTTTCCGCATGAAGAAGCAGTGGTTCTTGGTGCAG
CTGTCCCGCATTGCTACCCCAGTGACTGAAGCCGTCGCCAAACTGAGTACGTCTCCATATTGTTGAGTGCCGTGGCTCCTGCAATGAAGCTAACCTTTTG
ATTGCCCACACTTGAAGCAGTGACGCGGGAACGGATCATTCAGCAGTCGCTGCAGCTTGCTGAGGCCCCACCTGACGCCCTTCACGCGTATTTGAAGATT
ACGTTTGATGGTGAGCCGGGTATCGATGCAGGTGGTCTGCTACGAGAGTGGTTCGGAATCGTCTGCAAACAGATTTTCAGTGAGAAGATGGGCCTCTTCG
TCCCCACGAAGGGCGAAGACATGAGCTATTGGATTGACCCGCTCTCTGATGAGAAGAACGAAACCCACCTGAAGCTGTTCCGCCTAGCTGGTATCTTGAT
CGGCAAGGCGCTTTTTGAGGGTCTTGTGCTTGATGCCCACTTAGCTCTGCCGTTGCTAAAGCACGTGCTTGGTATTCCAATCTCGTTCTCCGACCTTGAG
TTCCTCGACGAAGAGCTGCACCGGAACTGCAAGTGGCTTCGCAGCAACAATCACGTGGAAGCTCTTTGCCTGACGTTTAGTGTGATGCTTGAAAATGGTA
CTGAGGTGGATCTCAAGGAAAATGGACGCAACGTCGACGTTACTGACGAGAACAAGGAGGAATACTTACGGTTAGTCCTCGAACACCGCATGCTGGACAG
CATTGCTGACCAGTTGCAAGAGTTCCTCATGGGCATCTACGATGTGGTGCCGAAGGCGCTGCTGTCTGTGTTCGACTACCAGGAGCTTGAGCTGATCCTT
TGCGGCATCCCCACTATCGACACGGCTGACTGGAAGGCGCACACTCACGTGCGCTACATCAAGCCCGAGGAAAACAGAAAAGGCAACATCACCGAAGAAG
AGCAGAACGGAGTGCTGCAGTGGTTTTGGATTGTTGTCGAGGGTCTTGCACCCGAGGAACGTGCTCGGCTGTTGCAGTTTGTCACTGGAACCAGTCGCGT
GCCCGTCGAGGGCTTCCGTGGGCTCATGAGCTCCAGCGGTATCATCCACCAGTTCACGATCCAGCTCGTGACGCGGGGCAAGAAGGAGAAGGCGGACCTG
TTCCCCAAAGCGCACACATGCTTCAACAGACTCGACTTGCCCATGTACCGCGACATGGAGGAGCTGGAACGAAGCTTGACAATGGTATCTCAAATGGAAG
TCTTTGGCTTTGGCCTCGAGTAGAGGCAATAACAAAAGTGCTATCCAATATATATGGCAGCAACTCGCGTGTGTAAGCTGTAGTTCTGAATCATTCAAGT
TGCCGTGACTTACAAAAGTGTTCGGAGTTGCGTTATTTAGTCTGGTCCTTCAGCTTGGCAATATGCGCAGCGACATCTTGCTGCAGCATCTCCTGATGGC
GTTTATCTCTGCGACCTTGAGAGCCGTCCAACGACGAACTTAGCCACGCAGGCGAGGCTGCAGCCTTCTGCTCTCCCGGCTGCTCCTTCTTCAGAACGGC
CAAAGCCGCCTCGATCTTGCTCTCACTTGTAGCCAACTTCATATTTTCTTTTGTTTTATCATCAGCAGCACTTGCAACCGTTGCGGCGCTCTGTCGACTA
GCCATAGCCTCCTCCTCCAGTCGTCGGAGGCGGTTGCGCATTTCCTGGATAGCGGATGCCAGCGCCGATTCCTTGTCCTGCTGCTCCTGGACGGCATTTA
TCTCGCTCTCTACCTGCTCCATGCGGAGCGCCTCGTTCTCACGGTCCATCCGTCTCTTCACAGAGTAGAGGTACAACCCCAGCACAGTGCCAGGCCCGAA
GGCGAACAAGCCGTAGAAAAGCTTACGTCTCGGAGACAGCAACTTCCTGCGGGGGGCAAACAGCACGGCGACATCAGATACAAAGCAGTTCTAGTGTTAT
AGTTGGCGTTTACACACTCAAGCGCGTCCGGAGGCGCGTCCGAGAAGAGCATCTT