Description :
From Genome Similarity Track
Location :
Scaffold_181:16691- 23763
Transcript NameFunction/comments
Phyta_totarag5176conserved hypothetical protein
Phyta_totarag5177conserved hypothetical protein
Phyta_totarag5178unnamed protein product

Sequence
7072 bases(100 bases per row)
GCCCCATCTCGGAGCCGCATCTTACGAATCTATGTTTTATCCTAAGCTTCCCTTTCAATACATTTCCTATGTAAATGGCAGTATCAATTCTTCTTGCCAG
GTTTTGCCTGCCATCTGGCCTCACTAGGGTCAAGTGCTCTGACTCCTTGCCTAGGAAACCGTGCAAAATTTTGCACCCGCATCGCTGCCGTTCACCCGCG
TGCAGTCTCGGGTCTTCTGTGCGACGCACCAGGTGGCCCACAAGTTCATTGGCCACTTGACTCTTTCCGTGCCTGGTAAGACCAGTTTTCGTGGGTGAAA
AGCCTCTGTCGTGCCGATGCCGTCCCCTCAATCGAAGGCGACCATGCCAGTCGCGAGTAACAAACCTGCTGAGCCCAGTCTGGAGAACTGTCGAAGTGTG
AGCGACGTGTCGTCGACTACCGCGTACGACTCTGCCAttgagcaggaagaagagaacaCAAAGGACGCAGCGAGCGGAGACGAGAAGGACTGTGACTCCG
TCGAGAGCGAAGACCTCGTAGAAGCTGAGGTCGAGCcggaaggagctggtggaaaggagagcgaggagacGGAAAGCTTGAAGGAAAAGGCGGCaggtga
agaggagaagaaggaggttGTCGAGGCTGCAGTAGTTGAtctgaaggaggagaagcccGCGGGTACCAAGACTCAAGACGAACCGGAGCTGGAAACGCCC
AGTGACGACTCGTGgaaagaagaggagaagcagctacaacagcagaagaaggagcaaACGTCGTTGGCACGTCCTGCTACTGCGAGAAGTGCCGAGTCGA
GTTCTGTTTCGCGACGTCCATTTGTCCCGTTGGCGTCCAAGAGTTGGCGTGTGCGAGCCATGCAGTCCAACACGCAGATTACGCGCCTTATGAAGGCGGC
GTTGCttcagacgctgctgcacgctaTCCGAACTGGATCGGTGGAGGGGGTGAAGGTCGCGATTGAACGTGGAGTGCAGGTGCAGTACCTGGACAGCCGC
CAGCGCAACCTCGTCATGCTAGCATCTAAGTGCGACACCGATGCTCGTCTGCACATCGTGATTATTTTGCTAGACGCTGGCTGTGATATGAACCACAAGG
ACCAGCTAGGCTGGAGTTGTCTGCATTACGCTTGGTACGTTCTAAGACCCTCGAGAACTCTTTGCGTTTTGCCTGAATATTCGTATGCGCAAGACTAACC
ATCCATTGATTTGGTTGTTTGTGTTTATTCAGCGCCAGCGGAGCTGACGATGTGGCTGCGGAGCTCATTCGCCGCGGAGCTCGCGTCGAGTTCAACCCGT
ACGGATATGGTCCTGAAGACTTCAACATCCCTAAGGTGGCGCGTGCGAAAAGTCTGTTACAACACACggagcagctacagcacgAGCAAAATGTctgtgc
tgcttggacgtaCTTTCGCCGTCAGGCTGAGAAGTCCAGCTACAGTGTCAAGTGCAAATCGGTATGCGGATGGCTATCGGCTGAGTTTTATGTGAAGTAC
AGGAGGACTAACTGCTCGCGTGTTTGCTTGCTTTCTTGTAGAACTGCGATCTTGGCAAGCCTCTGAAGATCACGTTTCAAGCCCCTGCTGGGCATAGCCC
TCTGGACCGCATCCGTGTGGTTGACATGAACTCGGATGTGGCGCTGTGGTTGCAAGTTTCAAAGACCTTCAGTATCCCTCCTGGCGATGTGGGTACGATC
ACGTTAGATGTCGAGACGCTCGACCGCCCGTCACTGTATCGTATCGTTTACGAGAAATACGAGCCGACGCCCATTCAGCTACCAGCCTCGGTTGCTGAAA
GTAACTTGTGCGTCAAGAACCTAGACACGGGAACCACGGTGTCGATGGGCAGCATCAATAACTTGGTTCTAAAGGAGCTCCAGAGCTCTCGatcgtcgaa
gaagtcaAAGAAATTGTCGAACTCGGCCAGGTAAGCAGAGGATACCACATTGTGTTAGACTGGTCTGATCTTACGAGCGCTGTGATGTTCTCTCTATAGA
CCAGCGCCCAAGTCGGACAAATCTGCAAGCGTGGTGCGAAGAGGATCGACAACGTGCGTCTGCTATCCAGCATGTTAAAAGtgctatacatgtataattG
GATATGGCTAATTTTTTGTAATGTGGTTACAGTCGAGCCCGGGAGATCACTGAAAGAGTGCGTGAAGCCACagtggaagaaggcgaagaagaagaggctg
ATTTTTCAGCTGATGAGACGATTACGACGCAGGAGGTTGCTGAGCACCCAGCGGTGACGAGTATTACTGGTGTGTACAAAATCGTGGCTATGGGGGTTGT
CAGCGTTTCGACGCTGATAACTGCAAAGGCGAATGAGTACGAAATCTCCATTCGTCGCAAGGGCCCACTTGGTCTCCAGTTGGTACGATTTGTTGATGTT
TCCTGGCAGGAGCCATATCAAAAGGGAATGCGCCTCCAACTCCGTTATTGTTATTTTGCGTGCAGGCGCCCAAGATTGAAAGCTTGAAGAGATCCCCACG
TCTTATTGTGCGGCGTAGTCAGGgccaaactgctgctgtgaacCCGGGTGATTGCCTTGTTGCGATTGGTAACGCTAACATTGAGCACGCTGGTCTCAAG
CACACGCTGTGGGCACTAAACGATGCTAAACGGCCTCTTGTGCTTCGCTTCCGGCGTGGAAATGCCAAGGAGAAAAAAAGTCTGTTCAAGACTGGACTGT
CCAAGCTTACAGGACCTCGTAGACAACCTGTCATTGCGGTGTAGTCTTGTTGCTCAGTGAGGTGCGCTTTTTCTTTTGGTAGGATGAATATAAACAAAAG
TTGTGAGGTTGATGCGTGAAGTTGTGAATCGATTGAGCGTTTGAGGTTAACCTTACAAAGTAAACTTGTCCTGCGCGTGCTTTACTTTTCAGGCTGGATG
AGGTAGCACGGTCTGGGCTACAGCATTGGGTGGCCTTTGTCTACATGACAGTATTTGAATGTCCTGTTCTGACTAGTGCATCGTCGGCATAATGCTTCGG
GCTTGGTTGACACGTCAATAACATGCAATGGGTGTGCCTGCACAAAAATTAGGCAGAAGTCATCCGTCAGACTCGTCCCATTTCTACAATTCgatgtacc
ggtacaatAGAAACTCACCCTAAAGTGCTCCAGTAAATCGTCTGGATGAACCTGTATGCGGGTTTCTGTCTCGGGGTCGTAGACAATTGCAGGGTCTGTC
ACAGTCATAACATTATGCAGGTTAGGCACGTGCTCTCTCACACAGCTCGGATAAAGAATCCTCACATTGCTTGCCGTCACCACGCCATAGATACCAAGCT
TGTGCCTCCCACCATGCCGGCTCCAACGATCCAGCATTTTGATACTATTCGTAACGATAACAatggtacagcagcagcaatattAGCATGAAATCCTACG
AAGACAAGAGCATACCGTACTGTAAGCAACTTACTGCGATCGCTAGCATCGATCCTGGCCGTAGCGCGCTCGCCCAAGATTTCACGTGTAGCAAGAAGTC
ATTAGGTGCTTTACTCGccgcgtacttcttcatcagctgCCACTCGCCGTCTTTCCCGTTGCCGCGCCGCTGAAGCCATGGGTTATGACCATGGAACGTC
CACGTGTTGGGCAGTATGATACGGTGCGGCTCGTTCGGATCCACGTAGACAACGCCGAAAGCCCAATGCGGGAACTGTTGCCTCATCGGACCCGTCTTGT
AGCCTGTATAGTAGACGAAGAGCTTGTGCACACATGTCATCTGGTTGTGCATGAATTGCGACCACGACTCCTTCGCCTTGggcttctcctgcttgagcAG
TTTGTCCAGTGAAGCTTCAGCCAGGAACTCCCCCGTCGCCTGCTTGGCTATGACGTCCACGTCGCGCTTGAACGTCTTGTTGGTCTGTCGGCAGGTCACA
CCACACGTCAGCAACGCAACTGCCTCCAGACTCATCCACCAGTCTCTTCGCCCTGTACTGCACGCACCATTCCTAGTCGACCGAGCGCAAGGGGCGCCAG
GAACGCTGCAATACGCAGCTTGAGATCGaagttgagctgctgaatgTTGGTCACTTTCTGGTACTTACGCGTCATGGCCTTCGCCGAGACAGTAGCTGGG
CCGTCCACTCGGCGTTTCTTGGTGGCGGCTTTTCCTGCCAGATTCTTCTGAAAGTACGCGCTCTCGACGCGCAACATACAAGAGCAGACGTCGCGGCCGT
TGCAGCGACGCGTGTGGCGCACGAGTTTGGCGTCGATGAGAGAAGCAGGCGCCATGGAAGGGCTCACGGCCTCGGCCATTGTCGCcgccgtctgctgctc
cgagTTCATTTTGGCTTCTGGCGGTTCGTACCGTAACCAGCAGATGCGACAGAAATTACCGGTATTAGACTGATTACAGTAATTTATTTATCTGAGCTCA
AAATTAGTCTTTGCTCATAATTAGTGTCAGACTATTTCAAGTGCTCCAGAATTACCTCCCCGATACATTTTTCCTCCCTGATGCCCTAATCCCTAATTAC
TTAAGTTACTTTACAATAACCACTCTATTTTAGTAGTAAACCGTCCCTTTCTAAAGATTAAAAGCCAGGAATTAATGAGCATTTTCTAAAGTTAATCAGA
GATTAAATGAGAGAGATAAAtcacagtacatgtaacgttaaCTGGATTGTGATCGTACGCCTATCATTTGTGCCGATGCTGGGGCAGAGACTGCGGCGAG
AGGGGGCCGTGCAGGCGAGCGAAACGCGTCGCTGGCTGACACTTACCACCAAGGCGAAGGCCGTCAGCCGCGTGAGAGGTACAAGAGACTTGCTGGCTGA
TgattcgcagcagcatcgtgaGGTGCTGGATAGGCTGCAGAGCACCGTGGAGCGCTATGGGTTTCGCTCGGTGCGTGTAGAATGTCAGATTAATGCATGG
TCTGGTGGTTGCTTTAATATACTGACAACTGACTGCTTCCAGATCCAAACGCCGCTACTCGAGTACACTGACTTGTTCTCGAGGTCGCTGGGCGACGGCT
CTGATATTGTCATGAAGGTGTGTGGGAGTGGAAGACCAGACGACCATGGATAAGAGAACACTGTGCATTAAAATGGTCGTTTGCAGGAGATGTACACGTT
CAAGGACAACTCGGGCAAGAGCGTGACGTTGAGACCTGAAGGCACTGCTGGTATGCTGATTTGACACATCAAGATTgtgcgactgctgcgagtGTCACCG
CTCACGGTTTACGGTGATGATGTGTTTTTGCAGGTATCATGCGGGCTCTTGTAAGCAATAATCTGCTTTTCTCACTGCCGCAGAAGCTCTCGTATTCGGG
CAGCATGTTCCGGTGCGTAAGCCTGTGGTGACATCGCTAGTTCTGTGTTCGTATAGTATAATCTAACTGTTTGTTCCTGTTGTTGAGGATACAGATACGA
ACGTCCTCAGCGGGGAAGGTACCGGGAGTTCCAGCAGTTTGGTAAGTTCTCGGTGGGATAAGTTGTGCTTGTGTGTGGAATAGAGGACGATCTAATGTTA
TCGCCTGCGCGTCATTGTGTCAGGCGTGGAATTCGTGGGCTCTTCGGGCCCATCGGCCGATACAGAGGTACGATTCATCACGCTCTTGCTTTGCGAAATT
GTTGGTACGATTACTGCAGTGGGCTTACGCAAACTGGTGCCGATGCAGGTTATTGCAATGGCTGCTGATGCTTTGGACGCCCTGGGCATTAAGGACAAAG
TCGTGCTGGAGTTGAACTCTCTTGGTGATAACGAAAGGTAACGAGGGATTGTTCTGCACGACTCTATCAGCGGAGAATTCAGTGTGACTATGAAGGCTCA
TACTGATTCTTATTTTGTCTCGATAGCCGCGCAAGGTATCGGGCCGCACTAGAAGATTTTTTCTCGAAGTGCAAGGAGGACCTATCATCGGATAGCGTCA
ACCGGTTCGTTGCCCTTGTCTGGCTTGGATTATGCTTTGAGCGTGCACTAACAGTTAGTTCGCTCACAATTTGCCAGTCTTGAACGAGGGAGTGTTCTTC
GGATTTTGGACTCGAAGAGTGAGATCGACCAGAAAATTATTGTTGATGCGCCGCAGCTTAGCAACTTCCTCTCTGACGAGTCCAAAATGGTAGAAGTGGG
GTAACTGTTGCCCCGCGTGCTTTATGTAGCACTCACATTGATCCTCATGTTGTGCTTTTAGCGCTTTGACAGTGTTCTGAGTGGCTTGGACGCGTTGGGT
ATCAGCTATCAACAAAATCCACGCCTTGTGAGAGGACTGGTATGGCCTATTGCTTGCTGCATGTTCGACCGGCGATGACAAAAGTTGTTCACTTTgtatt
gctgttgctgactcGAATGCCTGGCAGGATTACTACAGCAACACCGTGTTTGAGTTTGTCGAACGACCAGCATCGGATGCTTCTGATACAGAGGAAGCAA
CTCGAGGTGGTATTGCAGTGCTTGCGGGTGGTTGCTACGATGGGCTAGCGGAGTCTTTAGGAGGGCCTGCGACGGCTTGTGTGGGCTGGGCGGCAGGCGT
CGATAGGTTGAATCTGCTTCGCGAGATGCCGACCGAGACGATGTCCTCCGTTGCGGTACGTTGAATGCGTTGTTTAAAGAAACATATCACTGTAGTCTAA
TGTTTTGCGTATGCTTTGTTGGTGCTTTGTAGGTCGTCCCCGTTCTTGCTGGTGACGATTCAAATCGAGTCCTTCACGAAGCTATGCGTATCGCACAGGT
ACGCTGGGGTTGTCTTTTGCTCTTTCCCAACGTGTTTTTGGCGTGCATTACAATACACTGTATCGGTTCTTTTCCAGACGCTCCGACAACGTGGCCTGAC
GGTTCATTTCTGCCATGGACGCGGTAatatgaagaagcagatgaaggtgatgaTACTTTTTAAGAGGGGCGAGCAGCCAATGTACTCGTACTCATTTAAT
GTTattcttgctgctggtacaggCTGCTGAGCGCTACGGTAGTACTCATGCTGTGATTCTGGGCGGAGCAGAGATTGAGCAGCAGTGTGTGAAGGTGAAA
AACCTTgagaagcgcgaggaggccgaggtgccgatggaggagctgagCAGCTTTGAGTTCCTTTGAGAATAC