Description :
From Genome Similarity Track
Location :
Scaffold_98:16691- 18880
Transcript NameFunction/comments
Albla_Nc14067250endo1 putative
Albla_Nc14067240endo1 putative
Albla_Nc14067220endo1 putative
Albla_Nc14067230endo1 putative
Albla_Nc14067210endo1 putative

Sequence
2189 bases(100 bases per row)
GTGCTCCCTCCTGTGTCTGCTTGCCCACCCTCTGAAATCTTTCAAAGAACCGGGGAGTTGCGCAAACTCATCCATCCTCACTTTGTAGAGCATCTAGGAG
ATGCGATCGCTATTCCAACAAACGATTGGTGGGGTAATCTGCTCGCTTGGAAAGATCGACAAGAGAGTGATCCTGTGTTTGCGAGTCCCTACACTCACAT
AGTGTCACCCACAAGCCTCTCGACAAGCTACTTGTATCAGTTTATGGCCAAAGGTCCCAGTAACGACAATAATGCTATCAAGTTTTATTTCTACCCAGCG
ACTATCAAAGGTGTGATTTTTGGAGCAGAAGAATTTGACTGTGCGACGAATTTCAAGATAAATGGATGGGATGATATCGGAGTCCGTTTAGAATGGTCTC
ACAAGGTCCATACGAATGAGGTTCCGCAATCAATGCAGACATATTTGGCAACCGGCGCAGCCTTTACGACAGTTCATTACGTGAATCTACATGCGAAAGT
CTCGTTCGGACACGCTATTGTGTCAATCAATCAGGAGCCCGGTGTAGTGGGACGCGTGTATTGCGGCAAAAAACTCGTGGTTTCGCTCAACAACAATCAG
CAGTGGACGTTGTACATTTTAAGTACTAAAGAACATGAACTCATATTCCAGGGTGACCACTTCACCACGAGAGAGAGATTCACTGGTGCTTTGCAAGCCG
CAATTCTTCTTCACGAAACTTCGGAGCAGGTAAATGTATTGTATGACTCGGTGGCTGGCGTATATGTAAGTGGAGGACGCTTCTGTTTCGATGCAAATGG
CTCTAGCACGAGCTACGATATTGAATGGGATATTCGAAATTGTATAGATGGACAAAAAGAGACTCAATTCTTACATTTCGCATTGGAACACCATATGAAA
ATACTATGTGGTGAGAATCTACAATTGATGCCAATGCTTTCATTACACAGTAACACTCGAGGTCGCATGCGAGCATTTTTGACTCGTAATACCCTCAATT
GGCACTTTGTCATTCCGACTGATATCGACCAAACGGTGGATGCATGTCTTCAGTTTTATTCTCCGCGTGAGATATCAATGCAAGACATCACTCATTGGAA
ACTGTGCGAGATTTTACAAAACGAAATCGAGGCTGAAGACTGGCCCAATGCAAAGAATCCGGAAGCGAGCTATTACTTTCGAGGCAAAACCTTACAAAAG
ATTGGAACTTTGTGTTTACTCTCTGCCAAATTGGCAATTTTGACGAAATGCCCGACCATGACAAAGCTCGCTGTGGCGATACGACAGACATTGAAGCAAT
ATCTTCTAGCGTTTGCGAAAAATGAATCCTGCTTTCCGCTCGTTTACGACACGGTGTACAAAGGTATCGTCTCAAGTGAGGGGCTCAAGAAAAACGATAT
TAATGTCGACTTTGGGAGCTTGGCTTATAATGATCACCATTATCACTATGGATACTTCATCACAGCAACAGCCATCTTATTATTCCTTGATACGGAATTC
GCGCAATCTCACGAAGCCCACTTGCTCAAAAGTGTCACAGAAAGTCTTATTCATGACGTCGCGAATACGGATTCTCATCAAAATCCTTATTTTCCATCGT
TCCGAAATTTCAATTGGTTCTATGGTCACTCGTACTCTCACGGAATCACACCGATGGCTGATGGAAAAGATATAGAAAGCATGTCAGAGGACATCAATTT
CTCCTATGGACTTGCTCTCTATGGATATGTGGTTAACGATGCACGTTTACATGTTACTGGTAGTCTAATGATGAAGCTGGAGGCTTTGGCAATTTCGACC
TACTTTTTCATCACTGAAGACAACGTCACCCATCCTCCCGAGTTTCGGAACAATAAAGTCACTGGCATGTTGTTTGATAATAAGTGTGATTACGCGACGT
GGTTCAGTCCAAATAAAGAGTGTATCCATGGCATTCAAATGCTTCCTATCATACCGGCAATGGAAGCGATTCGTCGAAGAGATTTCGTTCAAGAGGAATG
GAACAATGTTTTGTGCAAGCTTGATCCTGTCAAAAAGTGGCGAGAGTGTAATTCCGGCTGGACATCTCTTCTGTTCACGAACTACAGTCTTATTGATAAA
AACGAAGCATGCAAAGTACTTTCAGAATGCGCGCTCGATGACGGGCTAAGTCGCGCTTGGGCGCTGTATTTTGCTTGTACGCGGCCTTC