Description :
From Genome Similarity Track
Location :
Scaffold_790:1669- 3158
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_790-fgenesh-gene-0.2Phosphatidylserine synthase

Sequence
1489 bases(100 bases per row)
GCCCACTGCATGGAGAGCGCGAGCAGCGGCGTGAAGCTGATCCAGAAGAGGACGTCGAGCTTGCCCCACGACGTGACGGCGCTGGGGTCCTGCGTTTTGG
TCGGTGATGCAAACAGCGAGCGGCGCCCCTTGGCCACGGGCGTGCGGGGTCGCGGCTGCGAGAAGAAGATCGCCATCCAAATGGAAAACATGACGAGAAA
CGCCAGGATGGGGAGGGCGACCTCCAACGGCGGAGGGCTCGTGAAGATCACGCCGGGCGAGAACTTGACCCACACGAGGACTTCAAAGCACGCGATCGAG
AGGATCATCCACGCGTTCTGGCCGAGCCGCCAGCAGTCGGGGTTCACGAGGAACTCATAGTACTGCCAAGGGATCAGTAGAAGAGGAGATCAGTTCATCT
GTCCATCGATCGAGGGATGAGGGGGAGAGGGAGAGAACGCACCTCGGCGGCGCCCTGGATGCCGATGAGAAACATGAGCGCGAGGCGGTAGCTGTTGAAG
TTGCTTTCCTTGGGCACGCTCAGCGTGTTGAGCAAAAAGAACGCATTGAGCTCAACGACCAGACACACGATGAGCGCAAAGAGAATCTATGCACCACAAA
CGTGATTAGATTCCGACATATGTCCCTCACACAGCATCAAAAATCAACATAAAACGTACCGACGCGAAGCGCTTGAAGTTGGAGAAGACTTCCCAGTCAT
ACGAGGCCCAGCTAATGGGCGTGAACTGGCTGAGCGCAAAGAGCAAGGCGCCCATCTTCTTCTCTTTCTTGCCCGACCAGTCGTACACTTTGGTCTCAAA
ATATGTCAGCGTGATGCGCCCGAGCACCATGCCCAAGAGGTTGGCGCCCAGCAGATCCATAAAGAGCGAGTCCCACCAGCACTCTTGAAAGTCCGGGATC
ACGAACTGCAGCGCGAGCTCGAGAAACTCGAACGCGACGCTGAGCACCCAGCAGAACCGCCAGTCGCGAAACATGCACATCTTGCCCCACCAGCCCGTGA
CGTGGGCCACGAACCAAATGCTCGAGACGCCGCGGTAGAGCGAGTTGGCGTTGATGTCGCAGTCGAGCTTCGCGCCGAGCGGCGTGAGCTTCTTGGCGGT
GCCGACTTCGGGGAAGAAAAACTGCATGCTCGTGATCGCGCCCGTGCGGCTCTGCACCGACAGCGCCGCGAGCAGCAAGAGGTAGACGACCGAGCAACCG
TGGACAATGCGCCAGACGCCCGGGTGCGGCCGCACCATGAGCGAGTCGCGCGTCTGCAAGAAGCAGTAGACGAGGAAAATGAGCACGCCCGTCGAGAGCC
CCGTGCGCACGTTGGTCACGACGTCGTCCGACTCGTGCGTGAACGAGTAGTAGCTGGTGGCCACGATGACGCACGCGAGCACGACCACTTGGCGCGGCTG
CTCGCGGAAGAGCAGCATGTCTTCCACGGCTTCGTTGCCCTGCGCCGCGCGGAACGCGTTCGTGCTCAGCGTGTCGGGCCGCGGACTGC