Description :
From Genome Similarity Track
Location :
contig_47:1669- 2715
Transcript NameFunction/comments
g9606.t1hypothetical protein

Sequence
1046 bases(100 bases per row)
CGTGAACATGTTGCCCTTGTCGGTGATCATGTCTTCAAAGTGGTTGGCAACATCATCTTCCTACAAGAATCACATTTGTATTAGGGTTAACGGAGGCCTG
GATCCTATGAAACGTTACATATACATAAGCCTCGCTGGGTCGTGCGTGAAATCGTAGTGCGTTAGAGCTTCTTGACATGGCTGGTGGCTCAAGTGGTGGC
TATTCCTTCTTGAAAATGGCACCGATCAGCAGCAGTATCTCCTGCGTGCGGGCACGCGTGTCCTCCTTCTCTGTAGCGGGGCTATACATTCGGTTCACCT
CCTACCTTAGTGCAACATGCACTAATGGATACATTTAGGTTGGCCACTCCACAGGGTGGTCCACATTCATAGCCAAAAGCATATGACTGGTAGAAAGTAA
CATCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTAGGAGGAAACCCCA
TTTACAATCAATACAGTTCTCATTTAGCACCAAAACTATCGTTCGGTCCCTTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGT
TAAATACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTGAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTC
CAACGACCGACTAACACGTTCGTATGGAATACAAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAAC
GCATGTTGCGCGTACAGACCGCCCCCACCTGTCGGAACCACCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGC
TATCGCCGACGGAGCAACACGATGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCG
CGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAG