Description :
From Genome Similarity Track
Location :
Scaffold_3:1668963- 1677101
Transcript NameFunction/comments
Physo_314409Hypothetical protein
Physo_299814serine/threonine protein kinase
Physo_545038choline/Carnitine O-acyltransferase, putative

Sequence
8138 bases(100 bases per row)
CCTTCTTTGGCGAGGCTCGACCCCGCGAGCGTGAGCGCGAGTGGCAATCATTCAAAGACGCCATAGGCAAGTACGAGCCGCGAGATAGCGCGTACATTGC
GGCGGTCACGCGGTTGTTAGAGCTGCATCGGGTCTTCATCGACGAGAATTGTCGATCTCTTCTGCGTCTGGGGGAGGAGACCGCGTCACGCTCACTGACC
GCACAATGTGCTGCGGAAAACCAGGCTTTGGTCGCGCTGGATGATCTGTGGGAGCGGTTCCAGCTCCCGGTATGGGACTCGCTCCTGGGCGACGAGAGCA
GCAGTCGATCACAGGTTGTCGGCGGGAAGAACCTGCACATGAAGAAGCGCTTGCTTGGAAATGCTGAACTGGGTATGGGAACGGCGTCGTCATCAGGCAC
ATCGACGGAGATCCCATCGCCGAAAGACCTGTCCTTCGCGCTGCGCAGTCTGCACATGGGGTCCGCTACAACGCTCGTGCAGTTCTGCAACACTGGCGTG
CTCGTCCTGCCACCGCCAAGCAGCATCGAGGACCAGCTCAGCTATCTCGAGATCTCCGTGGAGCTGACGTGGATGAACGCCGACATGAAAGAGCTCGAAG
AGCAGTACAAGAAGTTCATGCTGCATCGAAAGACACACCGCGAGCACCAGCGACTGTCCAGTGCCACCACTCGAAAACCTCCGAAATGTCCCCAAACAAT
AACAGGAGCGTCGTGCACAACCGCAGCTTCTTCGCTCTTGGCATTGAACAAATACTTCCACGAAGACGGGATTCCCGATGATAAAGCCCAGCAACTTGAG
TCGGCATCAAATGGTAACGGAGTATCATCCGTGAATAAGCCGACGAAGAGGGAAAACACCCCAGTATTCATCGTTCCAGCGTCCGAAATGGCTTGGTTTC
TCCGTGGCATCACTACCAATTGTGTCGATCACAGCCAACAGCTCCTTGATCTTCAAAATGCGTCCTTGCAGCAGCTTCGTGACCAATTTGAGGCCGTAAC
TCTCGAGTATCAGAAGATCAAGAAGCAGTGGGTCAAAGCCAAAGCTGAGGAGCGGATTCGGCGCGAGGCTTTCGCTGTAGACCACGCGTTCCACTTGTAC
TTCGAGGTGGAGGCTCTGCGGAAGCAGCTTGGAGTGCTGGAGGCACGCAGGGAGCTGGATCAGAAGATTTTGCGCTGCGATCTCAACGCCGAATACGACG
AAAAGCTGCGCGTGACGCACGCCGAGCTCCTGAACAAGCAGCAGAAGTTTGCAGAGTACCGCACGACCATGCAGCGCGAGCTGCAGACCGTGATCCAAGG
CGCCCACTCGCAGTTCGTCGACCAGATCTTGGACTACTCCGGCTCCATCCCTTCCGCGATCAAAACCTCGGTGGCAACACTTCTGCGCGGGCAACAAGAA
GTGGTGAGAATCAAGAGTGAGAACGCTGCTATGAAGCAAGCGCTCTTGAAGGTCCAGGCGCTGGGGGATATGCAGCAACAGACTCAGAGCGCCGCTCGAG
AGCGCGAGCTCCTACTTACCCAGAGATTCGCCACGGCTGAAGCTTTCCAACGTAACGAAGTGGAAAAGCTACAGGCGTACGTGAAGGAGCTTGAGGGGAG
TCTGAGTAAGCTGTCGCAGGAGAAGACGTACTTCCAGGTGAAATGGACGACAGCCCAGAAGCAAATGGAAGCCACAGCCCAGAGGAGACGAGAAGCCAGA
GTCCGCGCGCTGTCTGCAACGTACACCCGAACACTGCCGACAGGAGCCATAAGCACAGGCTCGGACGATGACAGTCCACCAGCAGTTGCCATCAACACGC
GCGTTCAAGTCGACGACACCGACAGCGTCACGGATGCCAGCACTACTCGTCCCCCAACAGCTACGAGTACAGTCGACGGAGCGCAGAAGCAGGAGCGCCA
GCGTCTTGAAGCGCAATATCTGAACACCACTCGACATTACCAGAACGAAATACGCCGATTGCAGCAGCAGGTCACGCGCGAGATCCGCGAGAAAGCAGCC
ATTGCCCAGCAGCTCACACAACTGCGCCAGCACGAGTCTTCAGCTTCAATTCAGTCACGCGATGGCCTGCCTCTCATTGACGACCCTCTGACACCGAGAA
CACCACGCGGAGACGACACTTTCAGCCGTAGAGATCACCTGCTGCCGTCCACCCCGCGCAGAACGCAGTCAGCATCACCTCGTACGCCCTCGAGAGCTCT
TGGCTGCGTCGCTGCTCCGCCGGATCGATCGACGACACCCAGACGTCCGAAGTCTTCCTTCTCCCCACGAGCCTCGCTGCTCCGCGCTCAAGTTGAAGTT
GGTTCTAGGTCCCAGCCGCCGCCACTCCTGCCATGTCCGAATGCTCCTGCTTCTGGGTCGAACACTCCGTCCTCGAGGCCGGGCAGCTCCGCTGGAACGT
CTGCGCGAAAATTTCAGGTGGTCAAGCGCGAAACGAACGTGGTAGACGGCGTCGCGGGCGTATCGAACACCCTGTCGGTCCGCGAGCCTCTGCAATATCG
CTGATCGATACAACTAACTCACTACGCGGATACAGTATGCAGCGCAAAGTGAAGCATACATTACAATAATACAGTAGAGCATTGAAGTGCAGCAGCAGCT
GCGGAGCACGACGGACCCGCGTCGCTCCCTCCGACTGCTTGTCCAGCCTTGTGGGCGGACATGGCTGCCTTCAAACCGCTCTGAGGAAATGAGAGAGAGA
GAGAAAGCGATACCGCACGACGAAATTGGAGGACAGAAGGAGGCTTGAGGCGACGTTCTGTCGCCTCAAGCCTCCACTCAGTCCTGCAGAAATGGCGCGC
TGCAGTGAGAGGGGATGGTGGACACGGATGGAGCTACACCCAGTCGTCGGATGTTCACAGTGTGGCGCTCACACTTACGCGCCGTCCTCCCTGCAAAAAG
TAAAATAAAATAAAAGAGTCAGTCTCACTTCATTCCTACTATTGCCAGCTCCACCACAGCTCGTCGTACCAGTCCGGGGACATGCCGAAGTAGTCCTCCA
TGGCGTCTTCTGCGTCGTCGTCCATGTTGGCAGGTTCGTCCATCGTCTCGTCGTCCATGTCACTATCATACGTCAGCCTGGCGGCAACCATAACAATGAA
AATAATAGTGTCAGCATCTAAAAAACTCCTCTCATTCCCCCCCTCCCCTCCATCGCAGCACTCACCCCTTGCAGAGGCACGTAAAGTACAACACCTTCTT
CTGCACCTTGTTGTAGAAGAAGTAGTTGAACGACCACCTACAAATTAAGAAAAAAATCAGACCCATAAACTACCCCCATACCGTAAATAAAAGTTGCCAC
TGTACGAACAGGTTGCCGTCCGAGAACGGGTCCGAGTCCATGTCGGGGATGTAGCTGTACACGTCGCACTCGTCGAGCTTGATGGCCTCGGCGATGCCCT
CCCACATCTTCTCCACGAAGCCGGCGCCCTCGCTCTCGAGCAGCTCGGCCAGGTCGTGGTTGATGCGCTGCAGCGCTATCCGGAAGTCGAGCTCCTTGCG
GAACTGCTCGGGCCGCGCGGCGCTGAAGTCGTAGTCCGGGAAGCTGGCGTTCATGGTGGAGATGAGGTTGATCAGCAGCTTTCGCGTGGCCGGCGCGGCG
ATGGGCCCGAGCGGGGACGAGCCCAGCAGGTCGGCGTCCGCGGCCTCGATCTCCTGCTGGTAGAAGAGCTCGAGCGACTTGGCCAGGCGCTTGTCGCTGC
CCGCCTTCTTGCACGAGTACGTCTCGATCTTGCCCTGGAGCACGCGGTCGCCCGCCTCGTAGTTGCCCAGCACCGAGTTGAGCCACGACAGCTGCGGCTC
CTCCAGGTACTTCATCGCGGCAGTCGAAGAGCTACGTAAGTCTTGCGCTTGGGGTTGCTTGTTGTTGAATGCGGCGCGTCAAGTGACTTGAGTTGAGTAT
GGCGACGCGTGAAGCGTCGATAATTTTTTTTAAAAAAATGTGAAAAATACTGTGAGGATTGATACATAGAGAAATTAAGAGATGTACGGCACTGAACCCA
CACTCACGTTACCTGTGCGGAACTCATATTTCGGATACTTCGGGAAAAACGCGGCACCTAGCCTGTTTCTTTGTGATGTTCAACGTGGCAGCACAAAATT
TCACGTACGCCACACCACTGTCGCAGCACTACCATACAGCATAACAACCCCAAGTTTAACTATCCCGACACCAGCATGCGGCGCTCGGCGCTGCGGCGGC
CCGAGAGCCTGACGGACAAGTACCGCATCCTGGGCAAGATCGGCGAGGGCACGTACGGCATGGTGTTCAAGGCGGAGGCGTACTCGTCGGCGCTGCTGCC
GCGGCCGTCCAGCGGCGGCTCGGGCGGCGCCGAGGACGAGGAGCCCATGACGTTCGCCATCAAGCTGGTCAAGTCGCACAAGGAGGGCAAGAACGACGTG
GTGCTGTCCAGCGCCACCGTGCGCGAGATCAAGCTGCTGCGCGAGCTGCACCACGACAACGTGGTGCATCTGCACGACGTGCACGTGGACCCGCGCGACA
AGTCGCTGGCGCTCGTGTTCGAGTACGGCGACCACGACCTGCACGACATCATCGTGCAGAGCAAGCAGAAGCCGCTGGGCGAGTACACGCGCAAGTCGCT
CATGTACCAGATACTGAAGGGCGTCGACTACATGCACGACGCCTGGGTCATGCACCGCGACATGAAGCCGCAGAACATTCTGGTAGTCGGCCACGGCCGC
AAGAGAGGACAGGTTAAGCTGGCGGATCTGGGTCTGGCCCGCATCTACAAGGAGCCCATCAAGGCGCTGTCCGACGTGGAGCGCGTGGTGGTCACGCTCT
GGTACCGCGCGCCCGAGCTGCTGCTGGGTGCGAAGCATTACACGAAGGCCGTGGACTTGTGGGCGGTTGGCTGCATCTTTGTTGAGCTGATCAACACGCG
CGAGCTGTTCTGCGGCAAGGAGGTGGAGGGGTCCAACGCTCCGTTCCAGAAGGACCAGCTGGACAAGATCTTCAAAGTGCTGGGCATGCCCACGCCGCAG
ACGTGGGAGGGGCTGGAGAACTTGCCCGAGTACAGCCATGTCGTGCAGATGGGACGCGAACGCAAGTACCCGACCCAGTCGGAGCTGAAGAATGCAGTTA
AGGTTGGGCCTGGCCGCGCGGGCGCTGCACTTCTGGATCTGCTTTCGAGGCTGCTGGAGTATGGTGAGTGCCAGGTGATCATGTCAGTTTCACTGCTCGT
TGCTGAGGATTTAACTCTGTACGTGCAGACCCGGAAACGCGCATCACGGCGAAGGAAGCACTGGAACACGAGTACTTCAAGGAGATCGTACGTGTTTCGT
GCCTATTGTAGTGCTGCTTGTTTTACAGTCTAACCGCGTTGCTTGGTGTTAACTTCGACAGGAGCCTGAACCAAGGGACTGGGCCTTTGACGAGCCTGGC
AAGGAACCTGTTTCCTTCCGCACGCAGACTGTAGAGCCCGTAGCGGAAGAAAACCTCCCGTGGAAGAGCAAGAAAGACGGCGCAGCAGGAGCTGACGGCA
AGCCGTCCGACGCTGCGGGTAGCCCTCACCGAGATGGTTCCAGTAGCCGTCATAATGACCATCGTGGACGTGACGCGCCATCGCGAAGCCGCAGCCACCA
CAACTCGCGAGATCCGCAGCAGCAACCTCAGCGACGAAGTGATCGTGGCAACGCTGGGGACGCGAACGCACGAGACACGAGAAGCAGAGGGCCTCCTGCT
GGAGGAAACGCGCAAGCCGCTGGAGGATCAGCTTGGAGAGACCAGAGGAGTTCTGGCCGTTCCGGGGGAGCTGCTGCACCTAATGCTGGCGCGATCACAG
GTGCCAAGCGTCCAAGTGGCGGCGAGCGCCCCACTAGCGCGAGTTCAAACCGTCCTCGGAGTCCAAAGCAGCCTCGCCGCAGGTGAAGGGACGAAGAAAG
CCAACGAATTAGGCTGCAGGCATTCAGTAAAACAACAGCAAACCACCAACATCAAGTGTCTGTGTTAGGCATTTCGTTTACAGCACTGGTAGAAGTTCTT
CGTCCTTCGCTTCTCCCTTACTTCTTGGGGGTGGTGTCGGCCAGCAGGCGCTCGAGCTCGACAATGCTTTCCACCAGCAGTTCCTTGAGTTGAGGAAGGT
CCTTGCGGTAGCTGGAGAGCTGGAAAGCAGAACCTTCTTGCTCGATTCCGTATCCGATGCCGTAGCAGTCCTCGTTCACAGGTCCAAAGCTACCGCCCTC
AAGCGCTGGGCTAGACAGCGTGCTGGTTGACAGGATAATCTTGCTCATAATTTGGTGGGCCGGCAGCGTGTAGAACTCCGGCGTGTCGATTCCCTGCAGT
TCAGCCATGGCTCGCAACGCAAAGAGGTGACGGTCAAAGCCCTGGCCCATCACACCGTTCTTGGTCAGCTCGCTGTGCTTCGTCACAGCCGCACGCAGGG
CATTGGCCTTGTCCGAGTCTGACGCAGAGGCATCGGTCATGGTGCGCACGAAAGCCACAGCTTCGTTCGTGCAGCTACGCACGGTTTCGGTACGTCCGTG
CTTGAATGCGGCAGTGCTGGCGCTCTCGTAGGTGGCCACAAACTTCTGGTGCAGTTTGAAGTGCGCCAGTTGGATCGTCATCTGCATGAGCCCGTCCGTG
CCAATGTTGTACTTCTTGCCAACAGCACGAGTCACGGGACTCTCCGCACACGCGACCAACAAGCTGGAAGTCCACTTGTCGTACGTCTTCTTCGCCTCGT
TCAGCAACTGCTTCGTCTCACCGTTGACGTCCCACGTCAGCTCCTTGGGCTTAGCTTGGCTGCTTGCCTTCAACACCGGGTACTTGACGCTGTCGCCATA
CAACTCGTGGAGGTAGCGCAGCACAGCCACACCGTCTCCCCAGGCGTGCTCAAAGTTCACCGAGGCCGTACCGTTCGCGGCTACTATTAGCTGAAAGCTC
TTATCGAACCAGTGGTTAGTGCCGTCGCCCACCAAGAACGTGCGGCTGACCTCTTCAGGCGTCGCAGGGGACTCATGCTCCAGGCTCACCACGAACAGCG
CGCTGTCAATCTGCTCCAGCGACGCCTTGTTGACGCCTCCACTGGCCTCCAGCTTCTGGCGAGCGTTAGCCCACGCGTCACGGTTCATGGTCGTCATGAG
CCCCATTCCAGGTGCATCCGGCGTGCTCTTCGCCAGTGGCTCAGCCAAGATCGCTTCAATATTGGCCAGGATCTGCTCGTCCGGGACAGCTCCTCCATCC
GCCGTGAGCACGTCAAAGGTATAGAACTTGGTTCCTCTCTGAACCACAACGTGCTTCGATCCCGGCGACACCTTGAGCTCATCTTGTCCGATCTTGGGCA
GCCTCGTGCTGGAGAACAGGTTCTTGTACTGGGACATGTCCAGCGGGTACGCGCCGAGCGCCGCGGCTCCGTAGAAGCTCACACTCTCGGGCAGGAACTT
ACAGAAGTACTGGAAGGCCGTGGTCTTGCTGGTATCCGGCTTGGTGTGGAAGATGTCCGGCTCCAGCTTCTTGTCGCGCAGCGTGCGGTGCACGCGCACG
GTGGAGGCGATGAGCGAGGCCGCGCGCTGGCTCTGCGAGTTCTTGGCGGGCACGGGGTCCATCTTGAGCTTGATCTGCGGGTTGTAGTTGACGGGCAGCG
GCTGCCGGTCGTTCAGGTACATCTCGAGCCACCACTGGTTGATGTACGACGTGTGCTTGTTCTCGGCGTCGCGCGCCACCAGCGCCCGGTGCAGCTCGGG
TCCCACGCCGTTCTGGAAGTCCCTAACGGCACGCTGCGTGTCCGCGAGCTGCTGCGCCGTCACCACGGGCTCCACGGCGGCCAGGTAGCGCGCCAGCGAG
TCCTCGAGCTTGGGGATCGGCAGGCGCGTCAGGCTCTTCTGGAAGTGGTAGGTGGGGATGATGGTGTCCTGCACGTAGCCGCTGGCGGACGAGAAGGCGC
GGCGCAGGGCAAGTGCCGCGCGTGCGCGGGCAACGGTGGAAGCCTGCATCATCGCAAGGGGAAGCAGTGGGCACTGGAGAGCGGATCCTGAAGTGCGTGT
AAGATCGTTGACGTACGCTTCGCTTCAACACGTCGGATTGCGGCCAGGAACCGACGTGCTTCAATGTGTTCACCGTAAACGTCGTTTGAGATTTACTATC
TCTGTTCTGAAAATAATGCACCTTCAAAAAATATTTGC