Description :
From Genome Similarity Track
Location :
Scaffold_3:1668963- 1672640
Transcript NameFunction/comments
Physo_314409Hypothetical protein

Sequence
3677 bases(100 bases per row)
CCTTCTTTGGCGAGGCTCGACCCCGCGAGCGTGAGCGCGAGTGGCAATCATTCAAAGACGCCATAGGCAAGTACGAGCCGCGAGATAGCGCGTACATTGC
GGCGGTCACGCGGTTGTTAGAGCTGCATCGGGTCTTCATCGACGAGAATTGTCGATCTCTTCTGCGTCTGGGGGAGGAGACCGCGTCACGCTCACTGACC
GCACAATGTGCTGCGGAAAACCAGGCTTTGGTCGCGCTGGATGATCTGTGGGAGCGGTTCCAGCTCCCGGTATGGGACTCGCTCCTGGGCGACGAGAGCA
GCAGTCGATCACAGGTTGTCGGCGGGAAGAACCTGCACATGAAGAAGCGCTTGCTTGGAAATGCTGAACTGGGTATGGGAACGGCGTCGTCATCAGGCAC
ATCGACGGAGATCCCATCGCCGAAAGACCTGTCCTTCGCGCTGCGCAGTCTGCACATGGGGTCCGCTACAACGCTCGTGCAGTTCTGCAACACTGGCGTG
CTCGTCCTGCCACCGCCAAGCAGCATCGAGGACCAGCTCAGCTATCTCGAGATCTCCGTGGAGCTGACGTGGATGAACGCCGACATGAAAGAGCTCGAAG
AGCAGTACAAGAAGTTCATGCTGCATCGAAAGACACACCGCGAGCACCAGCGACTGTCCAGTGCCACCACTCGAAAACCTCCGAAATGTCCCCAAACAAT
AACAGGAGCGTCGTGCACAACCGCAGCTTCTTCGCTCTTGGCATTGAACAAATACTTCCACGAAGACGGGATTCCCGATGATAAAGCCCAGCAACTTGAG
TCGGCATCAAATGGTAACGGAGTATCATCCGTGAATAAGCCGACGAAGAGGGAAAACACCCCAGTATTCATCGTTCCAGCGTCCGAAATGGCTTGGTTTC
TCCGTGGCATCACTACCAATTGTGTCGATCACAGCCAACAGCTCCTTGATCTTCAAAATGCGTCCTTGCAGCAGCTTCGTGACCAATTTGAGGCCGTAAC
TCTCGAGTATCAGAAGATCAAGAAGCAGTGGGTCAAAGCCAAAGCTGAGGAGCGGATTCGGCGCGAGGCTTTCGCTGTAGACCACGCGTTCCACTTGTAC
TTCGAGGTGGAGGCTCTGCGGAAGCAGCTTGGAGTGCTGGAGGCACGCAGGGAGCTGGATCAGAAGATTTTGCGCTGCGATCTCAACGCCGAATACGACG
AAAAGCTGCGCGTGACGCACGCCGAGCTCCTGAACAAGCAGCAGAAGTTTGCAGAGTACCGCACGACCATGCAGCGCGAGCTGCAGACCGTGATCCAAGG
CGCCCACTCGCAGTTCGTCGACCAGATCTTGGACTACTCCGGCTCCATCCCTTCCGCGATCAAAACCTCGGTGGCAACACTTCTGCGCGGGCAACAAGAA
GTGGTGAGAATCAAGAGTGAGAACGCTGCTATGAAGCAAGCGCTCTTGAAGGTCCAGGCGCTGGGGGATATGCAGCAACAGACTCAGAGCGCCGCTCGAG
AGCGCGAGCTCCTACTTACCCAGAGATTCGCCACGGCTGAAGCTTTCCAACGTAACGAAGTGGAAAAGCTACAGGCGTACGTGAAGGAGCTTGAGGGGAG
TCTGAGTAAGCTGTCGCAGGAGAAGACGTACTTCCAGGTGAAATGGACGACAGCCCAGAAGCAAATGGAAGCCACAGCCCAGAGGAGACGAGAAGCCAGA
GTCCGCGCGCTGTCTGCAACGTACACCCGAACACTGCCGACAGGAGCCATAAGCACAGGCTCGGACGATGACAGTCCACCAGCAGTTGCCATCAACACGC
GCGTTCAAGTCGACGACACCGACAGCGTCACGGATGCCAGCACTACTCGTCCCCCAACAGCTACGAGTACAGTCGACGGAGCGCAGAAGCAGGAGCGCCA
GCGTCTTGAAGCGCAATATCTGAACACCACTCGACATTACCAGAACGAAATACGCCGATTGCAGCAGCAGGTCACGCGCGAGATCCGCGAGAAAGCAGCC
ATTGCCCAGCAGCTCACACAACTGCGCCAGCACGAGTCTTCAGCTTCAATTCAGTCACGCGATGGCCTGCCTCTCATTGACGACCCTCTGACACCGAGAA
CACCACGCGGAGACGACACTTTCAGCCGTAGAGATCACCTGCTGCCGTCCACCCCGCGCAGAACGCAGTCAGCATCACCTCGTACGCCCTCGAGAGCTCT
TGGCTGCGTCGCTGCTCCGCCGGATCGATCGACGACACCCAGACGTCCGAAGTCTTCCTTCTCCCCACGAGCCTCGCTGCTCCGCGCTCAAGTTGAAGTT
GGTTCTAGGTCCCAGCCGCCGCCACTCCTGCCATGTCCGAATGCTCCTGCTTCTGGGTCGAACACTCCGTCCTCGAGGCCGGGCAGCTCCGCTGGAACGT
CTGCGCGAAAATTTCAGGTGGTCAAGCGCGAAACGAACGTGGTAGACGGCGTCGCGGGCGTATCGAACACCCTGTCGGTCCGCGAGCCTCTGCAATATCG
CTGATCGATACAACTAACTCACTACGCGGATACAGTATGCAGCGCAAAGTGAAGCATACATTACAATAATACAGTAGAGCATTGAAGTGCAGCAGCAGCT
GCGGAGCACGACGGACCCGCGTCGCTCCCTCCGACTGCTTGTCCAGCCTTGTGGGCGGACATGGCTGCCTTCAAACCGCTCTGAGGAAATGAGAGAGAGA
GAGAAAGCGATACCGCACGACGAAATTGGAGGACAGAAGGAGGCTTGAGGCGACGTTCTGTCGCCTCAAGCCTCCACTCAGTCCTGCAGAAATGGCGCGC
TGCAGTGAGAGGGGATGGTGGACACGGATGGAGCTACACCCAGTCGTCGGATGTTCACAGTGTGGCGCTCACACTTACGCGCCGTCCTCCCTGCAAAAAG
TAAAATAAAATAAAAGAGTCAGTCTCACTTCATTCCTACTATTGCCAGCTCCACCACAGCTCGTCGTACCAGTCCGGGGACATGCCGAAGTAGTCCTCCA
TGGCGTCTTCTGCGTCGTCGTCCATGTTGGCAGGTTCGTCCATCGTCTCGTCGTCCATGTCACTATCATACGTCAGCCTGGCGGCAACCATAACAATGAA
AATAATAGTGTCAGCATCTAAAAAACTCCTCTCATTCCCCCCCTCCCCTCCATCGCAGCACTCACCCCTTGCAGAGGCACGTAAAGTACAACACCTTCTT
CTGCACCTTGTTGTAGAAGAAGTAGTTGAACGACCACCTACAAATTAAGAAAAAAATCAGACCCATAAACTACCCCCATACCGTAAATAAAAGTTGCCAC
TGTACGAACAGGTTGCCGTCCGAGAACGGGTCCGAGTCCATGTCGGGGATGTAGCTGTACACGTCGCACTCGTCGAGCTTGATGGCCTCGGCGATGCCCT
CCCACATCTTCTCCACGAAGCCGGCGCCCTCGCTCTCGAGCAGCTCGGCCAGGTCGTGGTTGATGCGCTGCAGCGCTATCCGGAAGTCGAGCTCCTTGCG
GAACTGCTCGGGCCGCGCGGCGCTGAAGTCGTAGTCCGGGAAGCTGGCGTTCATGGTGGAGATGAGGTTGATCAGCAGCTTTCGCGTGGCCGGCGCGGCG
ATGGGCCCGAGCGGGGACGAGCCCAGCAGGTCGGCGTCCGCGGCCTCGATCTCCTGCTGGTAGAAGAGCTCGAGCGA